Incidental Mutation 'R4702:Lama3'
ID356168
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
MMRRC Submission 041950-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4702 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 12578029 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1567 (L1567*)
Ref Sequence ENSEMBL: ENSMUSP00000140104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]
Predicted Effect probably null
Transcript: ENSMUST00000092070
AA Change: L3173*
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: L3173*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157717
Predicted Effect probably null
Transcript: ENSMUST00000188815
AA Change: L1567*
SMART Domains Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: L1567*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_Lam 78 122 2.66e-10 SMART
EGF_Lam 125 175 7.81e-8 SMART
Pfam:Laminin_I 230 496 1e-90 PFAM
low complexity region 579 594 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
LamG 800 960 1.67e-2 SMART
LamG 1008 1136 1.72e-17 SMART
LamG 1179 1294 3.96e-17 SMART
LamG 1399 1527 1.12e-34 SMART
LamG 1569 1702 3.41e-30 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,329,403 T1316A probably benign Het
4921509C19Rik T C 2: 151,472,589 T390A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Adra1a T C 14: 66,637,559 probably benign Het
Aff1 T C 5: 103,811,069 Y343H probably damaging Het
Antxr2 C T 5: 97,949,169 probably null Het
Ap1m2 A G 9: 21,298,295 F362L probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Armc3 A G 2: 19,309,981 N822S probably damaging Het
Atr A C 9: 95,920,355 T1767P possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bloc1s1 T A 10: 128,923,398 Q13L probably damaging Het
Blvra A C 2: 127,092,062 I125L probably benign Het
Caps2 T C 10: 112,208,347 F484L probably damaging Het
Cep76 A T 18: 67,634,898 I188K possibly damaging Het
Cidea T A 18: 67,367,428 F187I probably benign Het
Cntn3 T A 6: 102,165,331 N1025I probably benign Het
Cntnap3 A T 13: 64,778,862 C565S probably benign Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Cyp2d26 C T 15: 82,792,447 probably benign Het
Cyp2j12 A T 4: 96,132,993 probably null Het
Dnajb13 T C 7: 100,504,541 N229S probably benign Het
Dpys A G 15: 39,793,402 V423A possibly damaging Het
Eif4e1b A T 13: 54,787,325 I222F probably damaging Het
Eif5b A T 1: 38,018,877 N87Y unknown Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epha7 T A 4: 28,961,425 L890Q probably damaging Het
Fancm T A 12: 65,122,052 S1730T possibly damaging Het
Flrt3 A G 2: 140,661,655 F18L probably benign Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
H2-M10.4 A G 17: 36,461,982 I36T probably benign Het
Igfn1 G A 1: 135,967,209 S1873L possibly damaging Het
Ints12 A T 3: 133,096,785 D10V probably damaging Het
Kbtbd2 A G 6: 56,779,303 S483P probably benign Het
Kcnv2 G C 19: 27,323,567 A273P probably damaging Het
Klc3 T G 7: 19,395,831 D371A probably damaging Het
Ldhal6b G T 17: 5,418,307 H117Q probably damaging Het
Lrriq1 G T 10: 103,215,749 Q381K possibly damaging Het
Mrps31 T A 8: 22,419,738 L140Q probably damaging Het
Myo15b A G 11: 115,884,008 T2119A probably benign Het
Nkx6-2 T C 7: 139,581,540 D243G probably damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Papln C T 12: 83,781,983 T821I probably benign Het
Pitpnb T G 5: 111,371,352 V166G probably benign Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plcxd3 C A 15: 4,375,787 S25R probably benign Het
Ppargc1a T C 5: 51,495,696 I175V possibly damaging Het
Ppp1r13b T A 12: 111,833,281 Q687H probably benign Het
Prpf3 A G 3: 95,834,092 V584A probably damaging Het
Psen2 A G 1: 180,227,724 L399S probably damaging Het
Ptchd3 G A 11: 121,836,409 V370I probably damaging Het
Rasa3 G T 8: 13,570,394 D758E probably benign Het
Reck T C 4: 43,898,060 C113R probably damaging Het
Ric1 T A 19: 29,598,017 F1009I possibly damaging Het
Rrp12 T C 19: 41,871,536 N1035S probably damaging Het
Rtel1 T A 2: 181,352,169 S849T probably benign Het
Scn10a A T 9: 119,633,791 Y1060N possibly damaging Het
Selenov A G 7: 28,288,011 L314P probably damaging Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc7a14 T A 3: 31,230,398 Y263F probably damaging Het
Slco3a1 A G 7: 74,320,567 S431P probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Spopl A T 2: 23,515,297 probably null Het
Stk10 A T 11: 32,555,172 T69S probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tec G A 5: 72,783,731 P161L possibly damaging Het
Tnip1 A G 11: 54,924,402 S339P probably benign Het
Tsen34 T A 7: 3,700,633 V290D probably damaging Het
Tuba1a T A 15: 98,951,682 I5F possibly damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn1r63 T C 7: 5,803,517 R39G possibly damaging Het
Xylt2 A G 11: 94,669,529 Y307H possibly damaging Het
Zfp65 A G 13: 67,724,222 M1T probably null Het
Zmym4 T C 4: 126,923,165 I247V probably benign Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
Camelid UTSW 18 12419257 critical splice donor site probably null
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 unclassified probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6060:Lama3 UTSW 18 12556663 missense probably damaging 0.99
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7088:Lama3 UTSW 18 12582545 missense not run
R7100:Lama3 UTSW 18 12582644 missense not run
R7102:Lama3 UTSW 18 12552813 missense not run
R7103:Lama3 UTSW 18 12531879 missense not run
R7121:Lama3 UTSW 18 12462782 missense not run
R7133:Lama3 UTSW 18 12539786 missense not run
R7150:Lama3 UTSW 18 12468289 missense not run
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGACTCAAAACCCCTGGATTC -3'
(R):5'- AGTCTCTGTTAGTGGGCTCC -3'

Sequencing Primer
(F):5'- GTATCTCCCTGCTTAGGTGGC -3'
(R):5'- GTTAGTGGGCTCCGTCTCC -3'
Posted On2015-10-21