Incidental Mutation 'R4703:Ptpn21'
ID356238
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission 041951-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R4703 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98679392 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1096 (T1096A)
Ref Sequence ENSEMBL: ENSMUSP00000126975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably benign
Transcript: ENSMUST00000085116
AA Change: T1096A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: T1096A

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170188
AA Change: T1096A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: T1096A

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably benign
Transcript: ENSMUST00000221932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223321
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T A 13: 59,689,528 T248S possibly damaging Het
AA986860 T C 1: 130,743,355 V438A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Aox2 T A 1: 58,358,957 F1286I possibly damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgap5 C T 12: 52,517,583 P446S probably damaging Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Armc12 A G 17: 28,532,362 D110G probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
B4galt1 A G 4: 40,823,569 V174A probably benign Het
Bcl11a C A 11: 24,163,725 A356E possibly damaging Het
Bri3bp C T 5: 125,451,766 L110F probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Ccdc33 T A 9: 58,033,670 I430F possibly damaging Het
Cgn A G 3: 94,776,095 probably benign Het
Crbn T A 6: 106,782,922 I317F possibly damaging Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Dnah7a C T 1: 53,447,317 probably null Het
Dnajc12 A G 10: 63,386,650 probably null Het
Dntt T A 19: 41,039,803 D179E probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epn1 T A 7: 5,095,148 D319E probably damaging Het
Evpl C G 11: 116,222,505 R1453P probably damaging Het
Focad T A 4: 88,342,321 probably null Het
Foxp2 A T 6: 15,411,248 M542L probably benign Het
Gak T A 5: 108,569,877 Q1299L probably damaging Het
Galnt5 G T 2: 57,998,907 R173I possibly damaging Het
Gli1 G T 10: 127,330,855 P843Q possibly damaging Het
Gm5422 G T 10: 31,249,612 noncoding transcript Het
Gna14 T G 19: 16,598,980 V117G possibly damaging Het
Gpr6 T C 10: 41,071,041 T182A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifih1 A T 2: 62,598,876 L906H probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Ighd A G 12: 113,416,041 probably benign Het
Ighv11-1 A C 12: 113,982,002 I77R possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Il23r A T 6: 67,490,702 I27K probably damaging Het
Inpp5a A C 7: 139,558,923 N261T probably damaging Het
Ints8 T G 4: 11,223,785 Q686P possibly damaging Het
Iqcf4 T C 9: 106,568,320 probably null Het
Irf2bp1 C T 7: 19,005,571 R379C possibly damaging Het
Iws1 C T 18: 32,080,013 P165S probably benign Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcna10 A T 3: 107,194,610 I186F probably benign Het
Limk2 C A 11: 3,347,586 E329* probably null Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Notch1 T G 2: 26,471,158 K1107Q probably benign Het
Nsd1 T A 13: 55,214,063 D281E probably damaging Het
Olfml2a T A 2: 38,951,238 L262Q probably damaging Het
Olfr1294 T A 2: 111,537,768 I174L probably benign Het
Olfr231 A G 1: 174,117,398 I206T possibly damaging Het
Olfr371 A G 8: 85,230,608 T38A possibly damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr557 A T 7: 102,698,270 T11S probably benign Het
Otogl A C 10: 107,821,924 D1048E probably damaging Het
Oxnad1 T C 14: 32,095,470 W96R probably damaging Het
Pcdh15 A T 10: 74,450,163 D743V probably damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcnx C T 12: 81,895,164 T112I probably benign Het
Pctp T C 11: 89,987,273 E145G possibly damaging Het
Pip5k1b T C 19: 24,355,153 K389R probably damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Pnlip T A 19: 58,676,467 D242E probably damaging Het
Rims3 A T 4: 120,883,297 probably benign Het
Rnf219 A G 14: 104,506,208 L145P probably benign Het
Scfd2 T A 5: 74,519,595 Q299L probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc15a5 T C 6: 138,055,645 D237G probably benign Het
Slc16a12 T A 19: 34,674,891 H285L possibly damaging Het
Sox2 C A 3: 34,650,713 R100S probably damaging Het
Sspo G A 6: 48,500,453 C4969Y probably damaging Het
Stxbp2 A G 8: 3,632,521 S37G probably damaging Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tcf4 A G 18: 69,657,910 Y307C probably damaging Het
Thsd7b A T 1: 130,049,909 probably benign Het
Tnn G T 1: 160,116,245 D999E possibly damaging Het
Trmt13 C A 3: 116,594,598 W63L probably benign Het
Tsc2 T C 17: 24,604,909 N915S probably benign Het
Tyrp1 T A 4: 80,840,806 probably null Het
Uvrag A T 7: 98,989,587 I315N probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn2r59 T A 7: 42,012,262 I710L probably benign Het
Vmn2r82 A T 10: 79,378,807 H208L probably damaging Het
Wtap T C 17: 12,980,824 T91A probably benign Het
Xirp1 A T 9: 120,017,027 V930E probably damaging Het
Xpo4 T G 14: 57,590,108 H877P probably benign Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTTCAGAAGCTATGGGCC -3'
(R):5'- ACACCAACTTGCCTTCAGTC -3'

Sequencing Primer
(F):5'- GGCCACCATGCCCTTCTC -3'
(R):5'- TGCCTTCAGTCACCATCGGG -3'
Posted On2015-10-21