Incidental Mutation 'R0402:Zfp1'
ID35625
Institutional Source Beutler Lab
Gene Symbol Zfp1
Ensembl Gene ENSMUSG00000055835
Gene Namezinc finger protein 1
SynonymsFnp-1, mkr-1, Zfp-1
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0402 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111643401-111671011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111670243 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 285 (E285K)
Ref Sequence ENSEMBL: ENSMUSP00000148310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077791] [ENSMUST00000211926] [ENSMUST00000212072] [ENSMUST00000212206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077791
AA Change: E299K

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076964
Gene: ENSMUSG00000055835
AA Change: E299K

DomainStartEndE-ValueType
KRAB 8 71 8.91e-21 SMART
ZnF_C2H2 183 205 5.14e-3 SMART
ZnF_C2H2 211 233 9.22e-5 SMART
ZnF_C2H2 239 261 1.72e-4 SMART
ZnF_C2H2 267 289 5.59e-4 SMART
ZnF_C2H2 295 317 3.16e-3 SMART
ZnF_C2H2 323 345 5.21e-4 SMART
ZnF_C2H2 351 373 2.65e-5 SMART
ZnF_C2H2 379 401 8.47e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211926
AA Change: E285K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212072
AA Change: E266K

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000212206
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the zinc finger protein family. Some members of this family bind to DNA by zinc-mediated secondary structures called zinc fingers, and are involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Zfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp1 APN 8 111670418 missense probably damaging 1.00
R4381:Zfp1 UTSW 8 111670451 missense probably damaging 1.00
R4478:Zfp1 UTSW 8 111670543 missense probably damaging 1.00
R4894:Zfp1 UTSW 8 111669723 nonsense probably null
R6067:Zfp1 UTSW 8 111670343 missense probably damaging 1.00
R6078:Zfp1 UTSW 8 111670343 missense probably damaging 1.00
R6723:Zfp1 UTSW 8 111670339 missense probably damaging 1.00
U15987:Zfp1 UTSW 8 111670343 missense probably damaging 1.00
X0026:Zfp1 UTSW 8 111670112 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAAGTCGCTGCTCGTTAGCC -3'
(R):5'- GGACTATGCCATGTGAACCCTCTG -3'

Sequencing Primer
(F):5'- tccacacgggcgagaag -3'
(R):5'- tttcccacactccgcac -3'
Posted On2013-05-09