Incidental Mutation 'R0402:Zw10'
ID35626
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0402 (G1)
Quality Score160
Status Validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49068723 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 385 (T385A)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803]
Predicted Effect probably benign
Transcript: ENSMUST00000034803
AA Change: T385A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: T385A

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213787
AA Change: T67A
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 unclassified probably null
PIT4382001:Zw10 UTSW 9 49071644 missense probably benign 0.15
R0736:Zw10 UTSW 9 49064132 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2231:Zw10 UTSW 9 49064121 missense possibly damaging 0.79
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5637:Zw10 UTSW 9 49057650 missense probably damaging 1.00
R5983:Zw10 UTSW 9 49077445 unclassified probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTGCTTATGCAGAGGACTGAAC -3'
(R):5'- TTGTCTCCGAGAGCTTGGCAACTG -3'

Sequencing Primer
(F):5'- GGGGTATTCTGGAGCTAATTCC -3'
(R):5'- TTCACGATACATGTCTCAGAACG -3'
Posted On2013-05-09