Incidental Mutation 'R4704:Kntc1'
ID356284
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission 041952-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4704 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123811433 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1956 (E1956K)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably damaging
Transcript: ENSMUST00000031366
AA Change: E1956K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: E1956K

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000197265
AA Change: E14K
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,357,530 M147K probably damaging Het
Abca13 A G 11: 9,276,990 D582G possibly damaging Het
Abca2 T C 2: 25,443,412 L1683P probably damaging Het
Adam39 A G 8: 40,825,796 H408R probably benign Het
Adcy4 A G 14: 55,775,025 S554P possibly damaging Het
Ahnak T G 19: 9,012,258 probably benign Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Alkal2 T A 12: 30,887,196 S109R probably damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Arpc3 A G 5: 122,400,408 M1V probably null Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Ascc3 A G 10: 50,659,014 I668V probably benign Het
Bdnf T A 2: 109,723,692 M137K possibly damaging Het
C87977 A T 4: 144,208,592 I193N probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Cds2 T A 2: 132,300,602 Y239* probably null Het
Cpped1 G A 16: 11,885,629 probably benign Het
Ctu2 G A 8: 122,479,303 R261Q probably damaging Het
Cux1 A G 5: 136,249,201 V645A probably benign Het
Cyp4f13 A G 17: 32,925,735 C401R probably damaging Het
Dpt T G 1: 164,818,949 Y162* probably null Het
Ednra A G 8: 77,667,963 probably benign Het
Eepd1 A G 9: 25,482,826 T129A probably benign Het
Eif2s1 A G 12: 78,877,170 T134A probably benign Het
Eloa A G 4: 136,011,214 V145A probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Eng T C 2: 32,678,912 S484P probably benign Het
Eogt A T 6: 97,113,852 V442E probably damaging Het
Fam185a C T 5: 21,480,473 probably benign Het
Gm4922 C T 10: 18,784,819 V52I probably benign Het
Gnao1 A G 8: 93,811,376 E14G probably benign Het
Gpr75 C A 11: 30,891,110 A5D probably benign Het
Hbq1b T A 11: 32,287,448 probably benign Het
Hdac7 G A 15: 97,796,216 T724M probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Irak4 A G 15: 94,566,900 probably null Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kifc2 T C 15: 76,662,977 probably null Het
Kmt2c G A 5: 25,314,027 Q2362* probably null Het
Lama3 T C 18: 12,553,223 V2781A probably benign Het
Lipt2 A G 7: 100,160,327 E207G probably damaging Het
Mag A T 7: 30,909,173 L172Q probably damaging Het
Map1b A T 13: 99,430,475 C1913S unknown Het
Mical3 A G 6: 120,958,688 S1626P probably benign Het
Mslnl G T 17: 25,738,978 W65L possibly damaging Het
Muc20 G T 16: 32,779,074 A3332S possibly damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Nkx2-3 G A 19: 43,612,684 E62K probably damaging Het
Olfr791 T C 10: 129,526,302 L25P possibly damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcna-ps2 T A 19: 9,283,422 V15E possibly damaging Het
Plekhg3 G T 12: 76,578,238 G1285W probably damaging Het
Procr A G 2: 155,754,338 S142G probably damaging Het
Ptpn3 A T 4: 57,270,119 N14K possibly damaging Het
Rin1 C A 19: 5,054,990 L693I probably damaging Het
Ripk4 C A 16: 97,746,004 E290* probably null Het
Rnf213 A G 11: 119,440,349 Y2128C probably damaging Het
Saal1 T C 7: 46,699,740 probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Serpinf1 C A 11: 75,411,041 A263S probably damaging Het
Sgo2b A T 8: 63,927,790 D669E probably damaging Het
Slc30a9 T C 5: 67,342,273 probably benign Het
Sri A T 5: 8,062,430 probably null Het
Sspo G A 6: 48,498,704 C4918Y probably damaging Het
Szt2 A G 4: 118,393,829 Y361H probably damaging Het
Tbc1d12 T A 19: 38,901,337 W404R probably damaging Het
Tcf20 T C 15: 82,851,727 E1841G possibly damaging Het
Tep1 T C 14: 50,837,073 T1832A probably benign Het
Tmem132e G A 11: 82,443,531 A623T probably damaging Het
Tmem201 A T 4: 149,727,317 F357Y possibly damaging Het
Trappc13 T G 13: 104,166,821 probably benign Het
Trav6-5 C T 14: 53,491,426 Q47* probably null Het
Ubxn1 T A 19: 8,872,035 D47E probably benign Het
Vmn2r45 G T 7: 8,483,536 S251* probably null Het
Wnk1 A G 6: 119,965,744 L774S possibly damaging Het
Zfp189 T C 4: 49,530,081 S395P probably damaging Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
R7381:Kntc1 UTSW 5 123810908 missense probably benign 0.12
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGAGCCACAAGAACGATCCTTAC -3'
(R):5'- GTACGACAGTGCCTTCTTGC -3'

Sequencing Primer
(F):5'- GAACGATCCTTACAAAGACCTCTG -3'
(R):5'- TCGCAAGCATGACTAACCTGTG -3'
Posted On2015-10-21