Incidental Mutation 'R0402:Arhgap44'
ID35630
Institutional Source Beutler Lab
Gene Symbol Arhgap44
Ensembl Gene ENSMUSG00000033389
Gene NameRho GTPase activating protein 44
SynonymsAU040829
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0402 (G1)
Quality Score214
Status Validated
Chromosome11
Chromosomal Location65002039-65162961 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 65032077 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000093002]
Predicted Effect probably benign
Transcript: ENSMUST00000047463
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093002
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119723
Predicted Effect probably benign
Transcript: ENSMUST00000130420
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Arhgap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgap44 APN 11 65041449 missense probably damaging 0.96
IGL01553:Arhgap44 APN 11 65053118 missense probably damaging 1.00
IGL01868:Arhgap44 APN 11 65012078 missense probably damaging 1.00
IGL01996:Arhgap44 APN 11 65005496 utr 3 prime probably benign
IGL02093:Arhgap44 APN 11 65074534 missense probably damaging 1.00
IGL02962:Arhgap44 APN 11 65067161 splice site probably benign
IGL02963:Arhgap44 APN 11 65031663 missense probably damaging 1.00
IGL03032:Arhgap44 APN 11 65024212 missense probably damaging 1.00
R0071:Arhgap44 UTSW 11 65011895 missense possibly damaging 0.90
R0152:Arhgap44 UTSW 11 65011919 missense probably benign 0.13
R1109:Arhgap44 UTSW 11 65026816 missense probably benign 0.00
R1694:Arhgap44 UTSW 11 65053197 missense probably damaging 1.00
R1946:Arhgap44 UTSW 11 65012096 missense probably damaging 0.99
R2036:Arhgap44 UTSW 11 65041492 missense possibly damaging 0.83
R2356:Arhgap44 UTSW 11 65010025 missense probably damaging 1.00
R4342:Arhgap44 UTSW 11 65012061 nonsense probably null
R4657:Arhgap44 UTSW 11 65005452 critical splice donor site probably null
R4763:Arhgap44 UTSW 11 65039165 missense probably damaging 0.98
R4803:Arhgap44 UTSW 11 65053095 missense probably benign 0.00
R5652:Arhgap44 UTSW 11 65024238 missense probably damaging 1.00
R5663:Arhgap44 UTSW 11 65024291 missense probably damaging 1.00
R5833:Arhgap44 UTSW 11 65038677 missense probably damaging 1.00
R6000:Arhgap44 UTSW 11 65032084 frame shift probably null
R6001:Arhgap44 UTSW 11 65032084 frame shift probably null
R6046:Arhgap44 UTSW 11 65032084 frame shift probably null
R6066:Arhgap44 UTSW 11 65032084 frame shift probably null
R6160:Arhgap44 UTSW 11 65162549 unclassified probably benign
R6661:Arhgap44 UTSW 11 65010008 missense probably damaging 0.97
R7062:Arhgap44 UTSW 11 65011932 missense probably benign 0.25
R7388:Arhgap44 UTSW 11 65024268 nonsense probably null
X0022:Arhgap44 UTSW 11 65053212 missense probably damaging 1.00
X0061:Arhgap44 UTSW 11 65038645 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGACACGATTCCTTGGACAACAC -3'
(R):5'- CTGCAACATCAGAACACGGCATTAG -3'

Sequencing Primer
(F):5'- GGCTGAACATTATATAGCCCTGC -3'
(R):5'- AGGAGCAGGTAGACTTCCTATTC -3'
Posted On2013-05-09