Incidental Mutation 'R4704:Ift88'
ID356322
Institutional Source Beutler Lab
Gene Symbol Ift88
Ensembl Gene ENSMUSG00000040040
Gene Nameintraflagellar transport 88
SynonymsTg737Rpw, IFT88, Tg737, polaris, Oak Ridge polycystic kidneys, TgN737Rpw, orpk, fxo, Ttc10
MMRRC Submission 041952-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4704 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57424062-57517936 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 57480850 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000122063]
Predicted Effect probably benign
Transcript: ENSMUST00000122063
SMART Domains Protein: ENSMUSP00000113768
Gene: ENSMUSG00000040040

DomainStartEndE-ValueType
Blast:TPR 197 229 8e-12 BLAST
TPR 233 266 5.35e-5 SMART
TPR 272 305 5.78e-1 SMART
TPR 485 518 5.73e-5 SMART
TPR 519 552 9.83e-4 SMART
TPR 553 586 5.19e-3 SMART
TPR 587 620 3.87e-2 SMART
Blast:TPR 621 654 7e-12 BLAST
TPR 655 688 3.76e0 SMART
low complexity region 730 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154492
Predicted Effect probably benign
Transcript: ENSMUST00000171682
SMART Domains Protein: ENSMUSP00000130475
Gene: ENSMUSG00000040040

DomainStartEndE-ValueType
Pfam:DUF3808 1 164 2.7e-8 PFAM
Pfam:TPR_11 3 76 8.7e-11 PFAM
Pfam:TPR_12 3 77 3.8e-11 PFAM
Pfam:TPR_8 6 37 7e-4 PFAM
Pfam:TPR_2 7 38 1.8e-6 PFAM
Pfam:TPR_1 7 39 3.4e-9 PFAM
Pfam:TPR_7 8 41 1.9e-7 PFAM
Pfam:TPR_8 45 78 2.2e-3 PFAM
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display early to mid-gestation lethality, random patterning of the left-right body axis, neural tube defects, pericardial sac expansion, enlarged limb buds, polydactyly, and absent embryonic node cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,357,530 M147K probably damaging Het
Abca13 A G 11: 9,276,990 D582G possibly damaging Het
Abca2 T C 2: 25,443,412 L1683P probably damaging Het
Adam39 A G 8: 40,825,796 H408R probably benign Het
Adcy4 A G 14: 55,775,025 S554P possibly damaging Het
Ahnak T G 19: 9,012,258 probably benign Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Alkal2 T A 12: 30,887,196 S109R probably damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Arpc3 A G 5: 122,400,408 M1V probably null Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Ascc3 A G 10: 50,659,014 I668V probably benign Het
Bdnf T A 2: 109,723,692 M137K possibly damaging Het
C87977 A T 4: 144,208,592 I193N probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Cds2 T A 2: 132,300,602 Y239* probably null Het
Cpped1 G A 16: 11,885,629 probably benign Het
Ctu2 G A 8: 122,479,303 R261Q probably damaging Het
Cux1 A G 5: 136,249,201 V645A probably benign Het
Cyp4f13 A G 17: 32,925,735 C401R probably damaging Het
Dpt T G 1: 164,818,949 Y162* probably null Het
Ednra A G 8: 77,667,963 probably benign Het
Eepd1 A G 9: 25,482,826 T129A probably benign Het
Eif2s1 A G 12: 78,877,170 T134A probably benign Het
Eloa A G 4: 136,011,214 V145A probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Eng T C 2: 32,678,912 S484P probably benign Het
Eogt A T 6: 97,113,852 V442E probably damaging Het
Fam185a C T 5: 21,480,473 probably benign Het
Gm4922 C T 10: 18,784,819 V52I probably benign Het
Gnao1 A G 8: 93,811,376 E14G probably benign Het
Gpr75 C A 11: 30,891,110 A5D probably benign Het
Hbq1b T A 11: 32,287,448 probably benign Het
Hdac7 G A 15: 97,796,216 T724M probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Irak4 A G 15: 94,566,900 probably null Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kifc2 T C 15: 76,662,977 probably null Het
Kmt2c G A 5: 25,314,027 Q2362* probably null Het
Kntc1 G A 5: 123,811,433 E1956K probably damaging Het
Lama3 T C 18: 12,553,223 V2781A probably benign Het
Lipt2 A G 7: 100,160,327 E207G probably damaging Het
Mag A T 7: 30,909,173 L172Q probably damaging Het
Map1b A T 13: 99,430,475 C1913S unknown Het
Mical3 A G 6: 120,958,688 S1626P probably benign Het
Mslnl G T 17: 25,738,978 W65L possibly damaging Het
Muc20 G T 16: 32,779,074 A3332S possibly damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Nkx2-3 G A 19: 43,612,684 E62K probably damaging Het
Olfr791 T C 10: 129,526,302 L25P possibly damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcna-ps2 T A 19: 9,283,422 V15E possibly damaging Het
Plekhg3 G T 12: 76,578,238 G1285W probably damaging Het
Procr A G 2: 155,754,338 S142G probably damaging Het
Ptpn3 A T 4: 57,270,119 N14K possibly damaging Het
Rin1 C A 19: 5,054,990 L693I probably damaging Het
Ripk4 C A 16: 97,746,004 E290* probably null Het
Rnf213 A G 11: 119,440,349 Y2128C probably damaging Het
Saal1 T C 7: 46,699,740 probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Serpinf1 C A 11: 75,411,041 A263S probably damaging Het
Sgo2b A T 8: 63,927,790 D669E probably damaging Het
Slc30a9 T C 5: 67,342,273 probably benign Het
Sri A T 5: 8,062,430 probably null Het
Sspo G A 6: 48,498,704 C4918Y probably damaging Het
Szt2 A G 4: 118,393,829 Y361H probably damaging Het
Tbc1d12 T A 19: 38,901,337 W404R probably damaging Het
Tcf20 T C 15: 82,851,727 E1841G possibly damaging Het
Tep1 T C 14: 50,837,073 T1832A probably benign Het
Tmem132e G A 11: 82,443,531 A623T probably damaging Het
Tmem201 A T 4: 149,727,317 F357Y possibly damaging Het
Trappc13 T G 13: 104,166,821 probably benign Het
Trav6-5 C T 14: 53,491,426 Q47* probably null Het
Ubxn1 T A 19: 8,872,035 D47E probably benign Het
Vmn2r45 G T 7: 8,483,536 S251* probably null Het
Wnk1 A G 6: 119,965,744 L774S possibly damaging Het
Zfp189 T C 4: 49,530,081 S395P probably damaging Het
Other mutations in Ift88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Ift88 APN 14 57481386 unclassified probably benign
IGL00886:Ift88 APN 14 57478068 missense probably damaging 1.00
IGL00901:Ift88 APN 14 57444445 missense probably damaging 0.99
IGL01148:Ift88 APN 14 57439732 missense probably benign 0.19
IGL01346:Ift88 APN 14 57444405 missense probably damaging 1.00
IGL01474:Ift88 APN 14 57478074 missense probably benign 0.23
IGL02213:Ift88 APN 14 57478045 missense probably damaging 1.00
IGL02391:Ift88 APN 14 57481414 missense possibly damaging 0.64
IGL03087:Ift88 APN 14 57477957 missense probably benign 0.00
R0392:Ift88 UTSW 14 57496160 splice site probably benign
R0608:Ift88 UTSW 14 57496221 missense probably benign
R0718:Ift88 UTSW 14 57517413 missense probably benign 0.02
R1128:Ift88 UTSW 14 57517019 nonsense probably null
R1422:Ift88 UTSW 14 57438301 splice site probably benign
R1422:Ift88 UTSW 14 57472979 missense probably damaging 1.00
R1432:Ift88 UTSW 14 57437279 missense probably benign
R1518:Ift88 UTSW 14 57430628 missense possibly damaging 0.64
R1566:Ift88 UTSW 14 57441011 missense probably benign 0.36
R1819:Ift88 UTSW 14 57455519 missense probably damaging 1.00
R2239:Ift88 UTSW 14 57455504 missense probably damaging 1.00
R2273:Ift88 UTSW 14 57488936 missense possibly damaging 0.90
R2926:Ift88 UTSW 14 57488918 missense probably damaging 1.00
R3033:Ift88 UTSW 14 57478044 missense probably damaging 1.00
R3052:Ift88 UTSW 14 57430568 missense probably damaging 1.00
R3815:Ift88 UTSW 14 57440981 missense possibly damaging 0.88
R4411:Ift88 UTSW 14 57477979 missense probably damaging 0.99
R4703:Ift88 UTSW 14 57480850 unclassified probably benign
R4822:Ift88 UTSW 14 57441869 splice site probably null
R5355:Ift88 UTSW 14 57438242 missense probably benign 0.34
R5618:Ift88 UTSW 14 57481508 missense possibly damaging 0.72
R6602:Ift88 UTSW 14 57507259 missense probably benign 0.00
R6907:Ift88 UTSW 14 57445610 missense probably benign 0.23
R7241:Ift88 UTSW 14 57479997 missense probably damaging 0.97
R7243:Ift88 UTSW 14 57430536 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGAAGATCCCAATCAAGCTATTG -3'
(R):5'- AGGTGATGCAAATCATGGTTG -3'

Sequencing Primer
(F):5'- GAATGGCTGATGCAGTTGATCAGC -3'
(R):5'- CCAGCAACTGTCTGTAATGGGATC -3'
Posted On2015-10-21