Incidental Mutation 'R0402:Nt5c'
ID35635
Institutional Source Beutler Lab
Gene Symbol Nt5c
Ensembl Gene ENSMUSG00000020736
Gene Name5',3'-nucleotidase, cytosolic
SynonymsDnt, Dnt1, Umph-2, Umph2
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0402 (G1)
Quality Score109
Status Validated
Chromosome11
Chromosomal Location115490420-115491862 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 115490642 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 195 (*195W)
Ref Sequence ENSEMBL: ENSMUSP00000102140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021082] [ENSMUST00000035240] [ENSMUST00000106530]
Predicted Effect probably damaging
Transcript: ENSMUST00000021082
AA Change: D187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021082
Gene: ENSMUSG00000020736
AA Change: D187G

DomainStartEndE-ValueType
Pfam:NT5C 5 198 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035240
SMART Domains Protein: ENSMUSP00000046120
Gene: ENSMUSG00000057219

DomainStartEndE-ValueType
Pfam:Arm 87 127 4.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106530
AA Change: *195W
SMART Domains Protein: ENSMUSP00000102140
Gene: ENSMUSG00000020736
AA Change: *195W

DomainStartEndE-ValueType
Pfam:NT5C 5 158 6.8e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140181
Meta Mutation Damage Score 0.506 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotidase that catalyzes the dephosphorylation of the 5' deoxyribonucleotides (dNTP) and 2'(3')-dNTP and ribonucleotides, but not 5' ribonucleotides. Of the different forms of nucleotidases characterized, this enzyme is unique in its preference for 5'-dNTP. It may be one of the enzymes involved in regulating the size of dNTP pools in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Nt5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Nt5c APN 11 115491325 nonsense probably null
IGL01633:Nt5c APN 11 115491335 missense probably damaging 1.00
IGL02380:Nt5c APN 11 115491301 missense possibly damaging 0.88
IGL03228:Nt5c APN 11 115491161 missense probably damaging 1.00
R0631:Nt5c UTSW 11 115490714 unclassified probably null
R3727:Nt5c UTSW 11 115490648 nonsense probably null
R5371:Nt5c UTSW 11 115490817 intron probably null
R5373:Nt5c UTSW 11 115490817 intron probably null
R5374:Nt5c UTSW 11 115490817 intron probably null
Predicted Primers PCR Primer
(F):5'- CTGTCGTACAGCCACTGGATGAAG -3'
(R):5'- ATCTGGCCTGCTGGGATTAAGGAG -3'

Sequencing Primer
(F):5'- TCCCATCCTGAGCTGAAAAGG -3'
(R):5'- AGGAGTAAAAATGACCCAATTACAG -3'
Posted On2013-05-09