Incidental Mutation 'R3732:Aacs'
ID356377
Institutional Source Beutler Lab
Gene Symbol Aacs
Ensembl Gene ENSMUSG00000029482
Gene Nameacetoacetyl-CoA synthetase
Synonyms2210408B16Rik
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R3732 (G1)
Quality Score201
Status Validated
Chromosome5
Chromosomal Location125475814-125517410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125506262 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 294 (T294M)
Ref Sequence ENSEMBL: ENSMUSP00000031445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031445]
Predicted Effect probably damaging
Transcript: ENSMUST00000031445
AA Change: T294M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031445
Gene: ENSMUSG00000029482
AA Change: T294M

DomainStartEndE-ValueType
Pfam:ACAS_N 47 105 1.1e-11 PFAM
Pfam:AMP-binding 103 546 1.7e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144361
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrf4 C T 17: 42,672,581 G70E probably damaging Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Afg3l1 G A 8: 123,501,233 G547D probably damaging Het
Ambra1 G A 2: 91,810,131 R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,850,226 probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Calm5 T A 13: 3,854,337 N10K probably damaging Het
Camsap1 T C 2: 25,938,344 R1123G probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Ciz1 A G 2: 32,367,483 N180S possibly damaging Het
Cntnap3 G A 13: 64,740,999 A1162V possibly damaging Het
Cox5b C T 1: 36,693,260 P114L probably damaging Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Ddx4 T A 13: 112,611,982 I487F possibly damaging Het
Dnah5 A T 15: 28,409,122 E3562V possibly damaging Het
Dpf3 T C 12: 83,269,507 D330G possibly damaging Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam102a G A 2: 32,566,292 S322N probably benign Het
Fam111a T C 19: 12,587,550 L221P possibly damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gm5514 T G 19: 21,938,252 noncoding transcript Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Igsf10 A G 3: 59,325,714 F1866S probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Lrrtm4 A G 6: 80,019,655 probably benign Het
Lsamp T A 16: 42,144,572 L264H probably damaging Het
Mthfd2 T C 6: 83,313,475 E39G probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nlrp14 A T 7: 107,182,367 Y257F probably benign Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Olfr301 T G 7: 86,412,633 I90M probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Oxr1 T C 15: 41,848,701 I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pcdhga1 A G 18: 37,664,123 T727A probably benign Het
Pde9a A G 17: 31,448,427 E3G possibly damaging Het
Prl8a1 T C 13: 27,579,733 E37G probably damaging Het
Rlf C T 4: 121,148,324 G1153D probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Srp68 T A 11: 116,273,956 K51* probably null Het
Ssbp2 T C 13: 91,524,607 Y29H probably damaging Het
Sspo T C 6: 48,449,930 V231A probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tecta C T 9: 42,392,106 V77M possibly damaging Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Tubb2a T C 13: 34,075,264 E181G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,944,760 N4756K probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Zfp934 A T 13: 62,517,785 H347Q probably damaging Het
Other mutations in Aacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Aacs APN 5 125514190 missense probably benign 0.00
IGL00155:Aacs APN 5 125513171 missense probably damaging 1.00
IGL00906:Aacs APN 5 125503274 missense probably benign 0.00
IGL00910:Aacs APN 5 125508708 missense probably benign 0.00
IGL01613:Aacs APN 5 125512652 missense possibly damaging 0.48
IGL01796:Aacs APN 5 125513209 missense probably damaging 1.00
IGL02155:Aacs APN 5 125506286 missense probably null 1.00
IGL02585:Aacs APN 5 125515057 missense possibly damaging 0.78
IGL03218:Aacs APN 5 125484663 splice site probably null
PIT4283001:Aacs UTSW 5 125484655 missense probably damaging 0.99
R0328:Aacs UTSW 5 125516259 missense probably benign 0.00
R1478:Aacs UTSW 5 125503223 missense possibly damaging 0.94
R1511:Aacs UTSW 5 125514977 missense probably benign 0.00
R1544:Aacs UTSW 5 125516330 missense possibly damaging 0.82
R1616:Aacs UTSW 5 125484526 splice site probably null
R1709:Aacs UTSW 5 125489878 missense probably benign 0.00
R1725:Aacs UTSW 5 125482935 critical splice donor site probably null
R2424:Aacs UTSW 5 125513095 splice site probably null
R2472:Aacs UTSW 5 125506252 missense probably damaging 1.00
R3612:Aacs UTSW 5 125503187 missense probably damaging 1.00
R3766:Aacs UTSW 5 125506262 missense probably damaging 0.99
R4740:Aacs UTSW 5 125506252 missense probably damaging 1.00
R4911:Aacs UTSW 5 125506160 missense possibly damaging 0.68
R5433:Aacs UTSW 5 125515014 missense probably benign 0.01
R5477:Aacs UTSW 5 125511920 missense probably damaging 1.00
R5863:Aacs UTSW 5 125503223 missense possibly damaging 0.88
R6919:Aacs UTSW 5 125506163 missense probably benign 0.35
R6943:Aacs UTSW 5 125506298 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGGCTCTTGTGGTAGATG -3'
(R):5'- GGACTGCAGTGTTCTCTTGC -3'

Sequencing Primer
(F):5'- GATCCTGGGCCATATCTAGCTG -3'
(R):5'- GCAGTGTTCTCTTGCTCCAGG -3'
Posted On2015-11-11