Incidental Mutation 'R3732:Adgrf4'
ID356402
Institutional Source Beutler Lab
Gene Symbol Adgrf4
Ensembl Gene ENSMUSG00000023918
Gene Nameadhesion G protein-coupled receptor F4
Synonyms4632435A09Rik, Gpr115
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3732 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42656891-42692284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42672581 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 70 (G70E)
Ref Sequence ENSEMBL: ENSMUSP00000133261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024711] [ENSMUST00000164524] [ENSMUST00000167993] [ENSMUST00000170723]
Predicted Effect probably damaging
Transcript: ENSMUST00000024711
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024711
Gene: ENSMUSG00000023918
AA Change: G70E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164524
SMART Domains Protein: ENSMUSP00000129114
Gene: ENSMUSG00000023918

DomainStartEndE-ValueType
SCOP:g1qd6.1 20 44 1e-2 SMART
low complexity region 54 64 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167993
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132890
Gene: ENSMUSG00000023918
AA Change: G70E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170723
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133261
Gene: ENSMUSG00000023918
AA Change: G70E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 9.2e-36 PFAM
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sequence analysis of this gene suggests that it is encodes a member of the superfamily of G protein-couple receptors. G protein-coupled receptors typically contain seven hydrophobic transmembrane domains, interact with guanine nucleotide binding regulatory proteins, and detect molecules outside the cell and act to transduce these signals into intracellular responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aacs C T 5: 125,506,262 T294M probably damaging Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Afg3l1 G A 8: 123,501,233 G547D probably damaging Het
Ambra1 G A 2: 91,810,131 R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,850,226 probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Calm5 T A 13: 3,854,337 N10K probably damaging Het
Camsap1 T C 2: 25,938,344 R1123G probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Ciz1 A G 2: 32,367,483 N180S possibly damaging Het
Cntnap3 G A 13: 64,740,999 A1162V possibly damaging Het
Cox5b C T 1: 36,693,260 P114L probably damaging Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Ddx4 T A 13: 112,611,982 I487F possibly damaging Het
Dnah5 A T 15: 28,409,122 E3562V possibly damaging Het
Dpf3 T C 12: 83,269,507 D330G possibly damaging Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam102a G A 2: 32,566,292 S322N probably benign Het
Fam111a T C 19: 12,587,550 L221P possibly damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gm5514 T G 19: 21,938,252 noncoding transcript Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Igsf10 A G 3: 59,325,714 F1866S probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Lrrtm4 A G 6: 80,019,655 probably benign Het
Lsamp T A 16: 42,144,572 L264H probably damaging Het
Mthfd2 T C 6: 83,313,475 E39G probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nlrp14 A T 7: 107,182,367 Y257F probably benign Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Olfr301 T G 7: 86,412,633 I90M probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Oxr1 T C 15: 41,848,701 I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pcdhga1 A G 18: 37,664,123 T727A probably benign Het
Pde9a A G 17: 31,448,427 E3G possibly damaging Het
Prl8a1 T C 13: 27,579,733 E37G probably damaging Het
Rlf C T 4: 121,148,324 G1153D probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Srp68 T A 11: 116,273,956 K51* probably null Het
Ssbp2 T C 13: 91,524,607 Y29H probably damaging Het
Sspo T C 6: 48,449,930 V231A probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tecta C T 9: 42,392,106 V77M possibly damaging Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Tubb2a T C 13: 34,075,264 E181G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,944,760 N4756K probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Zfp934 A T 13: 62,517,785 H347Q probably damaging Het
Other mutations in Adgrf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adgrf4 APN 17 42666656 missense probably damaging 1.00
IGL00474:Adgrf4 APN 17 42675759 missense probably damaging 0.97
IGL00913:Adgrf4 APN 17 42666902 missense possibly damaging 0.81
IGL02134:Adgrf4 APN 17 42669690 missense probably damaging 1.00
IGL02225:Adgrf4 APN 17 42663378 critical splice donor site probably null
IGL02423:Adgrf4 APN 17 42672576 missense probably benign 0.06
IGL02945:Adgrf4 APN 17 42667366 missense probably benign
R0329:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R0330:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R1595:Adgrf4 UTSW 17 42667873 missense probably benign 0.09
R1739:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1762:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1783:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1785:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2038:Adgrf4 UTSW 17 42667863 missense probably damaging 1.00
R2069:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2140:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2142:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2230:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2232:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2288:Adgrf4 UTSW 17 42667511 missense probably benign
R3107:Adgrf4 UTSW 17 42666867 nonsense probably null
R4003:Adgrf4 UTSW 17 42669759 missense probably damaging 1.00
R4158:Adgrf4 UTSW 17 42667677 missense probably benign
R4160:Adgrf4 UTSW 17 42667677 missense probably benign
R4163:Adgrf4 UTSW 17 42667586 missense probably benign
R4865:Adgrf4 UTSW 17 42667265 missense probably damaging 1.00
R4940:Adgrf4 UTSW 17 42666529 missense possibly damaging 0.90
R5411:Adgrf4 UTSW 17 42667213 missense probably damaging 1.00
R5512:Adgrf4 UTSW 17 42667285 missense probably benign 0.03
R6421:Adgrf4 UTSW 17 42672501 missense probably damaging 1.00
R7089:Adgrf4 UTSW 17 42666533 missense possibly damaging 0.95
X0027:Adgrf4 UTSW 17 42667528 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGCCACCAGGTAGCTTTCG -3'
(R):5'- CGAGAAGGCAATTTGATAAAGTCC -3'

Sequencing Primer
(F):5'- ACCAGGTAGCTTTCGACAAG -3'
(R):5'- GGCAATTTGATAAAGTCCCAGAATG -3'
Posted On2015-11-11