Incidental Mutation 'R4735:Dnah7b'
ID356409
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
MMRRC Submission 041962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R4735 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46066955 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 33 (R33Q)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect unknown
Transcript: ENSMUST00000069293
AA Change: R33Q
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: R33Q

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188209
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,216,123 I1410N possibly damaging Het
4932411N23Rik T A X: 126,814,594 K296M probably damaging Het
4932438A13Rik T A 3: 37,004,967 N3267K possibly damaging Het
9230106D20Rik T C 10: 19,660,253 noncoding transcript Het
Acsf3 T A 8: 122,781,479 I238N probably damaging Het
Ahctf1 T C 1: 179,753,399 N1746S probably benign Het
Akap3 T C 6: 126,865,638 S407P probably damaging Het
Ankfy1 T A 11: 72,730,611 M241K probably benign Het
Ano7 C A 1: 93,400,494 T622K probably benign Het
App T C 16: 85,103,314 T83A probably damaging Het
Arhgef28 T A 13: 97,899,729 E1674V probably damaging Het
Asb2 C A 12: 103,325,058 V489L probably benign Het
Atrn T C 2: 131,020,990 V1330A probably benign Het
Brca1 A G 11: 101,492,175 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Celsr1 T A 15: 85,906,029 probably null Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Crb3 A G 17: 57,065,207 T85A probably damaging Het
Cyld T C 8: 88,729,650 S443P probably damaging Het
Cyp27a1 T G 1: 74,737,207 V434G possibly damaging Het
Cyp2b13 A G 7: 26,088,295 T339A probably benign Het
Dars A T 1: 128,376,234 L252* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Ddx55 T C 5: 124,566,476 F382S probably damaging Het
Dnm2 G T 9: 21,474,587 S302I probably damaging Het
Dock4 T A 12: 40,631,526 F75I probably benign Het
Dpp10 T C 1: 123,398,627 N365S probably benign Het
Dpy19l3 G T 7: 35,722,721 Q236K probably benign Het
Dsp T C 13: 38,196,040 S1655P probably damaging Het
Ebpl A T 14: 61,342,118 I117N probably damaging Het
Edc4 T A 8: 105,887,186 V386E probably damaging Het
Eif2s2 T A 2: 154,878,547 probably null Het
Elob A T 17: 23,827,588 probably null Het
Enox2 T C X: 49,069,677 I71V probably damaging Het
Fam160b1 A G 19: 57,371,229 E67G probably damaging Het
Fez1 A T 9: 36,860,845 K149* probably null Het
Fign A G 2: 63,980,438 Y163H probably damaging Het
Flnc G A 6: 29,455,813 G2048S probably damaging Het
Fras1 A G 5: 96,588,163 D539G probably benign Het
Frmd4b T C 6: 97,459,259 probably benign Het
Gan C T 8: 117,194,231 T402M probably damaging Het
Ganc T A 2: 120,436,623 silent Het
Ggt6 C A 11: 72,436,599 R103S probably benign Het
Gli2 T C 1: 118,840,322 D725G probably damaging Het
Gm15446 T A 5: 109,942,952 C357S probably damaging Het
Gm44501 A G 17: 40,578,919 N108S probably benign Het
Gm6309 A T 5: 146,168,244 D286E probably damaging Het
Gm6358 G A 16: 89,140,960 G29E unknown Het
Gm8251 A G 1: 44,061,701 I79T probably benign Het
Grik5 A G 7: 25,058,288 I422T probably damaging Het
Grin2c A G 11: 115,249,596 I1232T possibly damaging Het
Gsg1 C T 6: 135,237,407 R365H possibly damaging Het
H2-M2 A G 17: 37,483,244 S30P possibly damaging Het
Hcfc2 A G 10: 82,712,080 D302G probably damaging Het
Hk2 T C 6: 82,744,974 D128G probably benign Het
Hmcn2 C A 2: 31,383,775 Q1380K probably benign Het
Hsp90b1 G T 10: 86,693,955 P617T probably damaging Het
Htr1d A G 4: 136,442,886 E142G probably benign Het
Hydin G A 8: 110,555,632 probably null Het
Il1r1 T A 1: 40,293,295 N81K probably benign Het
Inpp5b T C 4: 124,783,967 S407P probably damaging Het
Itpkb T C 1: 180,418,215 Y766H probably damaging Het
Lyrm2 T A 4: 32,801,150 I65N probably damaging Het
Mink1 T A 11: 70,609,260 probably null Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Msx3 G A 7: 140,047,885 A157V probably damaging Het
Nrxn2 T G 19: 6,498,454 V59G possibly damaging Het
Nt5c3b T C 11: 100,440,906 T12A probably benign Het
Nwd2 G A 5: 63,808,251 R1726Q probably benign Het
Nynrin A G 14: 55,870,168 T911A probably benign Het
Olfr1179 T C 2: 88,402,923 T4A probably benign Het
Olfr266 T A 3: 106,821,680 Y293F probably damaging Het
Olfr490 A G 7: 108,286,313 M271T probably benign Het
Olfr609 C T 7: 103,492,060 V273M possibly damaging Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr659 C T 7: 104,670,993 T97I probably benign Het
Olfr805 A G 10: 129,722,923 I207T probably benign Het
Patl1 G T 19: 11,922,505 M220I probably benign Het
Pcnx2 A T 8: 125,828,041 probably null Het
Pigr A T 1: 130,846,554 T424S probably damaging Het
Pik3c2b T A 1: 133,067,049 D250E probably benign Het
Ppa2 G A 3: 133,370,425 E272K probably benign Het
Pramel7 G A 2: 87,490,843 Q283* probably null Het
Prelid3b A G 2: 174,465,890 I81T probably benign Het
Prpf38a T C 4: 108,579,045 I24V possibly damaging Het
Ptger2 A G 14: 45,001,838 D311G possibly damaging Het
Rab4b A T 7: 27,172,766 probably benign Het
Rad17 A C 13: 100,619,129 D581E probably damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Scaf4 C T 16: 90,252,432 D256N unknown Het
Serinc2 A G 4: 130,263,645 F82L probably benign Het
Serpina3g T A 12: 104,239,113 V37E probably damaging Het
Serpinb9c T A 13: 33,150,271 M263L probably benign Het
Shbg A G 11: 69,617,500 I67T possibly damaging Het
Slc25a48 G A 13: 56,449,074 probably null Het
Slc25a54 T C 3: 109,098,607 W144R probably damaging Het
Slc34a1 A T 13: 55,413,584 T621S probably benign Het
Slc6a18 A T 13: 73,666,435 C419S probably benign Het
Smc5 A T 19: 23,242,705 D389E probably benign Het
Smco3 T A 6: 136,831,638 E79D probably damaging Het
Sox5 A G 6: 143,960,835 F298S probably damaging Het
Sphkap A G 1: 83,279,117 S304P probably benign Het
Tcea2 C T 2: 181,686,721 T211I probably damaging Het
Tcf4 G T 18: 69,564,155 S34I possibly damaging Het
Tlr4 C T 4: 66,841,198 R743C probably damaging Het
Tmem183a T C 1: 134,360,882 E67G probably damaging Het
Tpr C T 1: 150,442,196 R2152C possibly damaging Het
Trbv15 T C 6: 41,141,424 I38T probably benign Het
Treh G A 9: 44,681,552 A125T probably damaging Het
Trio A T 15: 27,752,789 probably null Het
Ttn A G 2: 76,951,949 V981A probably damaging Het
Uap1l1 A G 2: 25,362,720 L436P probably damaging Het
Uba7 A T 9: 107,976,916 I182F possibly damaging Het
Unc13c A T 9: 73,693,338 S1375T probably benign Het
Usp48 C CT 4: 137,633,369 probably null Het
Utp20 A C 10: 88,816,918 V378G possibly damaging Het
Vmn1r69 A T 7: 10,580,999 probably benign Het
Vmn1r86 A T 7: 13,102,294 H218Q probably damaging Het
Vmn2r121 T A X: 124,128,638 I562L probably benign Het
Vmn2r45 A T 7: 8,483,473 I272N probably damaging Het
Wdr90 A G 17: 25,859,450 V320A probably benign Het
Wfikkn1 A G 17: 25,878,393 V319A possibly damaging Het
Whamm A G 7: 81,571,374 D18G probably benign Het
Wrn T A 8: 33,285,222 I605F probably damaging Het
Zdhhc18 A G 4: 133,613,867 F232L probably damaging Het
Zfp41 T C 15: 75,618,760 I187T probably benign Het
Zfp418 A G 7: 7,182,562 Y508C probably damaging Het
Zfp560 T G 9: 20,349,051 I172L probably benign Het
Zfp943 A T 17: 21,992,410 D159V probably benign Het
Zfp955a T C 17: 33,241,722 I479V probably benign Het
Zfpm1 T A 8: 122,335,480 V426D probably benign Het
Zic1 C T 9: 91,364,505 M171I possibly damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 intron probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46290734 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense not run
R7501:Dnah7b UTSW 1 46356554 missense not run
R7513:Dnah7b UTSW 1 46124346 missense not run
R7547:Dnah7b UTSW 1 46214413 missense not run
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCTACCTATGCCTCAGAGAG -3'
(R):5'- TGGAGCCAGTTTTGTGTCCC -3'

Sequencing Primer
(F):5'- GAAAGTTCTGCTCCAAATCTCG -3'
(R):5'- TTGTGTCCCGTTGTTACAATAAC -3'
Posted On2015-11-11