Incidental Mutation 'R0402:Zswim8'
ID35641
Institutional Source Beutler Lab
Gene Symbol Zswim8
Ensembl Gene ENSMUSG00000021819
Gene Namezinc finger SWIM-type containing 8
Synonyms2310021P13Rik, 4832404P21Rik
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R0402 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20707552-20723619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20710766 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 36 (F36S)
Ref Sequence ENSEMBL: ENSMUSP00000153700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]
Predicted Effect probably damaging
Transcript: ENSMUST00000022358
AA Change: F113S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: F113S

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably damaging
Transcript: ENSMUST00000223840
AA Change: F113S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000224129
AA Change: F36S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224165
Predicted Effect probably damaging
Transcript: ENSMUST00000224751
AA Change: F113S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225715
Meta Mutation Damage Score 0.478 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Zswim8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zswim8 APN 14 20718475 missense probably damaging 0.99
IGL00470:Zswim8 APN 14 20723181 missense probably damaging 1.00
IGL00675:Zswim8 APN 14 20716901 unclassified probably benign
IGL00896:Zswim8 APN 14 20716001 missense probably damaging 1.00
IGL01343:Zswim8 APN 14 20713341 missense probably damaging 1.00
IGL01736:Zswim8 APN 14 20714712 missense probably benign 0.11
IGL01961:Zswim8 APN 14 20712334 missense possibly damaging 0.76
IGL02331:Zswim8 APN 14 20723257 missense probably damaging 1.00
IGL02485:Zswim8 APN 14 20711887 missense probably damaging 0.98
IGL02662:Zswim8 APN 14 20713074 missense probably benign 0.14
IGL03001:Zswim8 APN 14 20714391 missense probably damaging 1.00
R0123:Zswim8 UTSW 14 20716490 splice site probably benign
R0362:Zswim8 UTSW 14 20721945 missense possibly damaging 0.58
R0458:Zswim8 UTSW 14 20718897 missense probably damaging 1.00
R1087:Zswim8 UTSW 14 20717865 splice site probably null
R1158:Zswim8 UTSW 14 20721668 splice site probably benign
R1171:Zswim8 UTSW 14 20713113 missense possibly damaging 0.94
R1389:Zswim8 UTSW 14 20710748 missense probably damaging 1.00
R1773:Zswim8 UTSW 14 20711530 missense probably damaging 0.96
R1780:Zswim8 UTSW 14 20716327 missense probably damaging 0.99
R1850:Zswim8 UTSW 14 20710747 nonsense probably null
R2421:Zswim8 UTSW 14 20719457 missense probably damaging 1.00
R3826:Zswim8 UTSW 14 20711089 nonsense probably null
R3965:Zswim8 UTSW 14 20713073 missense probably benign
R4301:Zswim8 UTSW 14 20713909 missense possibly damaging 0.91
R4499:Zswim8 UTSW 14 20714297 missense probably benign 0.05
R4633:Zswim8 UTSW 14 20718823 missense probably damaging 1.00
R4675:Zswim8 UTSW 14 20714613 missense probably benign
R4958:Zswim8 UTSW 14 20713465 missense probably damaging 1.00
R5255:Zswim8 UTSW 14 20721651 missense probably damaging 1.00
R5288:Zswim8 UTSW 14 20718871 missense possibly damaging 0.92
R5341:Zswim8 UTSW 14 20716054 missense probably damaging 1.00
R5495:Zswim8 UTSW 14 20722286 missense probably damaging 0.97
R5652:Zswim8 UTSW 14 20713427 missense possibly damaging 0.62
R6273:Zswim8 UTSW 14 20713453 missense probably benign 0.06
R6281:Zswim8 UTSW 14 20714640 missense probably benign 0.02
R6364:Zswim8 UTSW 14 20713011 missense probably damaging 1.00
R6426:Zswim8 UTSW 14 20718526 missense probably damaging 0.99
R6576:Zswim8 UTSW 14 20721874 missense probably benign 0.41
R6798:Zswim8 UTSW 14 20715992 missense probably damaging 1.00
R7059:Zswim8 UTSW 14 20714573 splice site probably null
R7243:Zswim8 UTSW 14 20714368 missense probably damaging 1.00
R7250:Zswim8 UTSW 14 20719968 missense probably damaging 1.00
R7311:Zswim8 UTSW 14 20721484 missense probably damaging 1.00
X0026:Zswim8 UTSW 14 20710632 splice site probably null
X0028:Zswim8 UTSW 14 20714657 missense probably benign 0.19
X0058:Zswim8 UTSW 14 20712990 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACCATCCCAATCTGTGTTTTGGAAG -3'
(R):5'- TCGCTGAAACTCATCCGCACTG -3'

Sequencing Primer
(F):5'- GAAGATGGATTGGTAATCCCATTG -3'
(R):5'- CCATTGGCTAGGCATGAATAC -3'
Posted On2013-05-09