Incidental Mutation 'R4735:Celsr1'
ID356524
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Namecadherin, EGF LAG seven-pass G-type receptor 1
Synonymscrash, Crsh, Scy
MMRRC Submission 041962-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R4735 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85898929-86033777 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 85906029 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172] [ENSMUST00000016172] [ENSMUST00000016172] [ENSMUST00000016172]
Predicted Effect probably null
Transcript: ENSMUST00000016172
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000016172
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000016172
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000016172
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226204
Predicted Effect probably null
Transcript: ENSMUST00000226840
Predicted Effect probably null
Transcript: ENSMUST00000226840
Predicted Effect probably null
Transcript: ENSMUST00000226840
Predicted Effect probably null
Transcript: ENSMUST00000226840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,216,123 I1410N possibly damaging Het
4932411N23Rik T A X: 126,814,594 K296M probably damaging Het
4932438A13Rik T A 3: 37,004,967 N3267K possibly damaging Het
9230106D20Rik T C 10: 19,660,253 noncoding transcript Het
Acsf3 T A 8: 122,781,479 I238N probably damaging Het
Ahctf1 T C 1: 179,753,399 N1746S probably benign Het
Akap3 T C 6: 126,865,638 S407P probably damaging Het
Ankfy1 T A 11: 72,730,611 M241K probably benign Het
Ano7 C A 1: 93,400,494 T622K probably benign Het
App T C 16: 85,103,314 T83A probably damaging Het
Arhgef28 T A 13: 97,899,729 E1674V probably damaging Het
Asb2 C A 12: 103,325,058 V489L probably benign Het
Atrn T C 2: 131,020,990 V1330A probably benign Het
Brca1 A G 11: 101,492,175 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Crb3 A G 17: 57,065,207 T85A probably damaging Het
Cyld T C 8: 88,729,650 S443P probably damaging Het
Cyp27a1 T G 1: 74,737,207 V434G possibly damaging Het
Cyp2b13 A G 7: 26,088,295 T339A probably benign Het
Dars A T 1: 128,376,234 L252* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Ddx55 T C 5: 124,566,476 F382S probably damaging Het
Dnah7b G A 1: 46,066,955 R33Q unknown Het
Dnm2 G T 9: 21,474,587 S302I probably damaging Het
Dock4 T A 12: 40,631,526 F75I probably benign Het
Dpp10 T C 1: 123,398,627 N365S probably benign Het
Dpy19l3 G T 7: 35,722,721 Q236K probably benign Het
Dsp T C 13: 38,196,040 S1655P probably damaging Het
Ebpl A T 14: 61,342,118 I117N probably damaging Het
Edc4 T A 8: 105,887,186 V386E probably damaging Het
Eif2s2 T A 2: 154,878,547 probably null Het
Elob A T 17: 23,827,588 probably null Het
Enox2 T C X: 49,069,677 I71V probably damaging Het
Fam160b1 A G 19: 57,371,229 E67G probably damaging Het
Fez1 A T 9: 36,860,845 K149* probably null Het
Fign A G 2: 63,980,438 Y163H probably damaging Het
Flnc G A 6: 29,455,813 G2048S probably damaging Het
Fras1 A G 5: 96,588,163 D539G probably benign Het
Frmd4b T C 6: 97,459,259 probably benign Het
Gan C T 8: 117,194,231 T402M probably damaging Het
Ganc T A 2: 120,436,623 silent Het
Ggt6 C A 11: 72,436,599 R103S probably benign Het
Gli2 T C 1: 118,840,322 D725G probably damaging Het
Gm15446 T A 5: 109,942,952 C357S probably damaging Het
Gm44501 A G 17: 40,578,919 N108S probably benign Het
Gm6309 A T 5: 146,168,244 D286E probably damaging Het
Gm6358 G A 16: 89,140,960 G29E unknown Het
Gm8251 A G 1: 44,061,701 I79T probably benign Het
Grik5 A G 7: 25,058,288 I422T probably damaging Het
Grin2c A G 11: 115,249,596 I1232T possibly damaging Het
Gsg1 C T 6: 135,237,407 R365H possibly damaging Het
H2-M2 A G 17: 37,483,244 S30P possibly damaging Het
Hcfc2 A G 10: 82,712,080 D302G probably damaging Het
Hk2 T C 6: 82,744,974 D128G probably benign Het
Hmcn2 C A 2: 31,383,775 Q1380K probably benign Het
Hsp90b1 G T 10: 86,693,955 P617T probably damaging Het
Htr1d A G 4: 136,442,886 E142G probably benign Het
Hydin G A 8: 110,555,632 probably null Het
Il1r1 T A 1: 40,293,295 N81K probably benign Het
Inpp5b T C 4: 124,783,967 S407P probably damaging Het
Itpkb T C 1: 180,418,215 Y766H probably damaging Het
Lyrm2 T A 4: 32,801,150 I65N probably damaging Het
Mink1 T A 11: 70,609,260 probably null Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Msx3 G A 7: 140,047,885 A157V probably damaging Het
Nrxn2 T G 19: 6,498,454 V59G possibly damaging Het
Nt5c3b T C 11: 100,440,906 T12A probably benign Het
Nwd2 G A 5: 63,808,251 R1726Q probably benign Het
Nynrin A G 14: 55,870,168 T911A probably benign Het
Olfr1179 T C 2: 88,402,923 T4A probably benign Het
Olfr266 T A 3: 106,821,680 Y293F probably damaging Het
Olfr490 A G 7: 108,286,313 M271T probably benign Het
Olfr609 C T 7: 103,492,060 V273M possibly damaging Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr659 C T 7: 104,670,993 T97I probably benign Het
Olfr805 A G 10: 129,722,923 I207T probably benign Het
Patl1 G T 19: 11,922,505 M220I probably benign Het
Pcnx2 A T 8: 125,828,041 probably null Het
Pigr A T 1: 130,846,554 T424S probably damaging Het
Pik3c2b T A 1: 133,067,049 D250E probably benign Het
Ppa2 G A 3: 133,370,425 E272K probably benign Het
Pramel7 G A 2: 87,490,843 Q283* probably null Het
Prelid3b A G 2: 174,465,890 I81T probably benign Het
Prpf38a T C 4: 108,579,045 I24V possibly damaging Het
Ptger2 A G 14: 45,001,838 D311G possibly damaging Het
Rab4b A T 7: 27,172,766 probably benign Het
Rad17 A C 13: 100,619,129 D581E probably damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Scaf4 C T 16: 90,252,432 D256N unknown Het
Serinc2 A G 4: 130,263,645 F82L probably benign Het
Serpina3g T A 12: 104,239,113 V37E probably damaging Het
Serpinb9c T A 13: 33,150,271 M263L probably benign Het
Shbg A G 11: 69,617,500 I67T possibly damaging Het
Slc25a48 G A 13: 56,449,074 probably null Het
Slc25a54 T C 3: 109,098,607 W144R probably damaging Het
Slc34a1 A T 13: 55,413,584 T621S probably benign Het
Slc6a18 A T 13: 73,666,435 C419S probably benign Het
Smc5 A T 19: 23,242,705 D389E probably benign Het
Smco3 T A 6: 136,831,638 E79D probably damaging Het
Sox5 A G 6: 143,960,835 F298S probably damaging Het
Sphkap A G 1: 83,279,117 S304P probably benign Het
Tcea2 C T 2: 181,686,721 T211I probably damaging Het
Tcf4 G T 18: 69,564,155 S34I possibly damaging Het
Tlr4 C T 4: 66,841,198 R743C probably damaging Het
Tmem183a T C 1: 134,360,882 E67G probably damaging Het
Tpr C T 1: 150,442,196 R2152C possibly damaging Het
Trbv15 T C 6: 41,141,424 I38T probably benign Het
Treh G A 9: 44,681,552 A125T probably damaging Het
Trio A T 15: 27,752,789 probably null Het
Ttn A G 2: 76,951,949 V981A probably damaging Het
Uap1l1 A G 2: 25,362,720 L436P probably damaging Het
Uba7 A T 9: 107,976,916 I182F possibly damaging Het
Unc13c A T 9: 73,693,338 S1375T probably benign Het
Usp48 C CT 4: 137,633,369 probably null Het
Utp20 A C 10: 88,816,918 V378G possibly damaging Het
Vmn1r69 A T 7: 10,580,999 probably benign Het
Vmn1r86 A T 7: 13,102,294 H218Q probably damaging Het
Vmn2r121 T A X: 124,128,638 I562L probably benign Het
Vmn2r45 A T 7: 8,483,473 I272N probably damaging Het
Wdr90 A G 17: 25,859,450 V320A probably benign Het
Wfikkn1 A G 17: 25,878,393 V319A possibly damaging Het
Whamm A G 7: 81,571,374 D18G probably benign Het
Wrn T A 8: 33,285,222 I605F probably damaging Het
Zdhhc18 A G 4: 133,613,867 F232L probably damaging Het
Zfp41 T C 15: 75,618,760 I187T probably benign Het
Zfp418 A G 7: 7,182,562 Y508C probably damaging Het
Zfp560 T G 9: 20,349,051 I172L probably benign Het
Zfp943 A T 17: 21,992,410 D159V probably benign Het
Zfp955a T C 17: 33,241,722 I479V probably benign Het
Zfpm1 T A 8: 122,335,480 V426D probably benign Het
Zic1 C T 9: 91,364,505 M171I possibly damaging Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 86032414 missense probably damaging 0.99
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85902864 missense probably benign 0.00
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85916723 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85939134 missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6186:Celsr1 UTSW 15 85921193 missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7371:Celsr1 UTSW 15 86030674 missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
R7491:Celsr1 UTSW 15 86032518 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CAAGGCATGTGTCCTTCTTGC -3'
(R):5'- GTAGCCAGCCCTTTACTTGG -3'

Sequencing Primer
(F):5'- CCTCGAGGAAATGTTGAGCCTG -3'
(R):5'- CCAGCCCTTTACTTGGTTTAAGGAG -3'
Posted On2015-11-11