Incidental Mutation 'R4745:Ptprq'
ID356666
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Nameprotein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission 042028-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R4745 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location107517049-107720051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107524253 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 2187 (R2187L)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
Predicted Effect probably damaging
Transcript: ENSMUST00000050702
AA Change: R2187L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: R2187L

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,307,453 Y619C probably damaging Het
Adck1 A G 12: 88,402,179 probably null Het
Agap3 A C 5: 24,451,125 probably null Het
Ankib1 A T 5: 3,732,566 H354Q probably damaging Het
Ankrd29 T G 18: 12,254,622 N301T probably benign Het
Arhgef4 A G 1: 34,807,275 T379A probably damaging Het
Arid1a A G 4: 133,753,106 V169A probably benign Het
Armc4 G A 18: 7,286,763 T156M probably benign Het
Bag2 T C 1: 33,748,336 probably null Het
Bmt2 A C 6: 13,628,687 Y332* probably null Het
Bpifb1 A T 2: 154,211,581 K248* probably null Het
Caap1 C A 4: 94,556,514 probably null Het
Calcr T A 6: 3,692,576 Y389F probably damaging Het
Capn1 C T 19: 5,993,916 V562I probably benign Het
Ccr1 T A 9: 123,963,948 T182S probably benign Het
Ceacam15 T C 7: 16,673,334 D86G probably benign Het
Cldnd1 C T 16: 58,729,643 T63I probably benign Het
Col12a1 A T 9: 79,652,086 probably null Het
Cystm1 A G 18: 36,393,295 probably benign Het
Ddx55 T A 5: 124,566,965 Y428* probably null Het
Ensa G A 3: 95,631,434 G118D probably benign Het
Fam208b G A 13: 3,590,069 T356I probably benign Het
Folh1 A T 7: 86,723,274 probably null Het
Foxj2 C A 6: 122,837,989 P328Q probably damaging Het
Fscn3 A G 6: 28,435,628 I417V probably damaging Het
Galnt7 T C 8: 57,542,727 probably benign Het
Gm11563 T A 11: 99,658,420 *169C probably null Het
Hfm1 A T 5: 106,901,843 D417E possibly damaging Het
Ighv15-2 A G 12: 114,564,610 S107P probably damaging Het
Itsn2 A G 12: 4,661,944 D904G probably damaging Het
Kif1b A T 4: 149,237,882 L860* probably null Het
Krt79 T C 15: 101,930,684 E450G probably damaging Het
Lama1 T C 17: 67,738,780 S227P probably damaging Het
Lamp5 C A 2: 136,060,866 H168Q probably benign Het
Lilra5 A T 7: 4,242,077 Q240L possibly damaging Het
Lrp1 A T 10: 127,549,944 C3521S probably benign Het
Mroh1 T A 15: 76,408,530 probably null Het
Nlrp4g A T 9: 124,349,515 noncoding transcript Het
Nr2f6 A T 8: 71,378,535 I70N probably benign Het
Nr4a2 T A 2: 57,110,151 D311V probably damaging Het
Olfr1490 T A 19: 13,655,386 M319K probably benign Het
Olfr248 T C 1: 174,391,876 L269P probably damaging Het
Olfr659 T A 7: 104,671,504 F267L probably damaging Het
Pcdhb6 C A 18: 37,335,373 A449D possibly damaging Het
Pcgf6 A G 19: 47,048,106 probably null Het
Prc1 C A 7: 80,313,163 H131Q probably benign Het
Rasl2-9 C A 7: 5,125,703 R76L possibly damaging Het
Rdh16f1 A T 10: 127,790,816 Y246F probably benign Het
Rit1 T C 3: 88,717,675 probably benign Het
Sash1 A G 10: 8,729,908 V906A probably benign Het
Scnn1b T C 7: 121,902,286 V108A probably benign Het
Sema4f A T 6: 82,918,284 I356N probably damaging Het
Shc4 A T 2: 125,649,277 L447Q probably damaging Het
Slc24a1 T C 9: 64,949,476 M50V unknown Het
Slc28a3 T A 13: 58,574,263 D269V possibly damaging Het
Slc35e1 A G 8: 72,492,322 S89P possibly damaging Het
Smpd5 T A 15: 76,294,808 H125Q probably benign Het
Snapc2 A G 8: 4,254,578 T31A probably damaging Het
Sox5 G C 6: 143,833,488 H606D possibly damaging Het
Spag6 A G 2: 18,737,296 T367A possibly damaging Het
Spag8 T C 4: 43,651,636 T413A probably damaging Het
Sptlc3 G A 2: 139,547,167 G156R probably damaging Het
Stx19 A G 16: 62,822,420 T200A probably benign Het
Tas2r116 A G 6: 132,855,705 T90A probably benign Het
Tbl3 A G 17: 24,705,330 probably benign Het
Tekt5 G T 16: 10,395,194 P76T probably damaging Het
Tjp2 C T 19: 24,096,666 E1086K possibly damaging Het
Topbp1 T C 9: 103,323,571 L601P probably damaging Het
Trav16 T A 14: 53,743,477 M41K possibly damaging Het
Trav6-5 C A 14: 53,491,503 N72K probably benign Het
Trpm3 C G 19: 22,715,295 T250S possibly damaging Het
Vps35 A T 8: 85,261,262 D753E probably benign Het
Vstm2a A T 11: 16,263,061 N149Y probably damaging Het
Vwa2 G T 19: 56,906,886 M497I probably benign Het
Zfat C A 15: 68,180,374 V517L probably benign Het
Zfp169 C A 13: 48,490,232 R473L possibly damaging Het
Zfp672 T C 11: 58,329,498 probably benign Het
Zranb1 T C 7: 132,972,714 V420A probably damaging Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AATGCTTGGAAACTATCAGGTGAG -3'
(R):5'- GGTCACCTTTATGAAGTACCCC -3'

Sequencing Primer
(F):5'- GGTGAGATGAATCGAAATCCATCTTC -3'
(R):5'- GTACCCCATGAATGAATGAATGC -3'
Posted On2015-11-11