Incidental Mutation 'R0403:Ntng1'
ID35670
Institutional Source Beutler Lab
Gene Symbol Ntng1
Ensembl Gene ENSMUSG00000059857
Gene Namenetrin G1
SynonymsLmnt1, A930010C08Rik
MMRRC Submission 038608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0403 (G1)
Quality Score145
Status Validated
Chromosome3
Chromosomal Location109780040-110144011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109934611 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 282 (A282V)
Ref Sequence ENSEMBL: ENSMUSP00000102180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000128219] [ENSMUST00000131027] [ENSMUST00000133268] [ENSMUST00000138344] [ENSMUST00000138953] [ENSMUST00000156177]
Predicted Effect probably benign
Transcript: ENSMUST00000072596
AA Change: A282V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106570
AA Change: A282V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 1.28e-3 SMART
EGF 388 420 5.12e-3 SMART
low complexity region 444 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106571
AA Change: A282V

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 408 440 5.12e-3 SMART
low complexity region 464 479 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106575
AA Change: A282V

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 3.33e-2 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128219
AA Change: A282V

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116579
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LamNT 59 295 1.5e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131027
AA Change: A282V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF 421 453 5.12e-3 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133268
AA Change: A282V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 365 397 5.12e-3 SMART
low complexity region 421 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138344
AA Change: A282V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 406 5.74e-6 SMART
EGF 410 442 5.12e-3 SMART
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138953
AA Change: A282V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 407 439 5.12e-3 SMART
low complexity region 463 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156177
AA Change: A282V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: A282V

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 387 419 5.12e-3 SMART
low complexity region 443 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189335
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Atrn G A 2: 130,906,859 C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Flrt1 A G 19: 7,095,919 L421P probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrp1 A G 8: 128,457,969 N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prkg2 T C 5: 98,994,645 E210G possibly damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rasal3 T A 17: 32,392,790 probably null Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sec24b A G 3: 129,999,534 S685P probably damaging Het
Sec24b T A 3: 129,989,676 L1104F possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smarcc1 T A 9: 110,237,808 probably null Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Ntng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Ntng1 APN 3 109934995 nonsense probably null
IGL02367:Ntng1 APN 3 110135513 unclassified probably null
IGL02448:Ntng1 APN 3 109934559 splice site probably benign
IGL02487:Ntng1 APN 3 109935047 missense probably damaging 0.98
IGL02500:Ntng1 APN 3 110135330 missense probably damaging 1.00
IGL02578:Ntng1 APN 3 110135394 missense probably benign 0.01
IGL03009:Ntng1 APN 3 109934702 missense possibly damaging 0.89
IGL03096:Ntng1 APN 3 110135349 missense probably benign 0.19
R0108:Ntng1 UTSW 3 109851755 splice site probably benign
R0326:Ntng1 UTSW 3 110135503 nonsense probably null
R0699:Ntng1 UTSW 3 109872295 missense probably damaging 1.00
R0702:Ntng1 UTSW 3 109872254 missense probably damaging 1.00
R1981:Ntng1 UTSW 3 109935010 missense possibly damaging 0.61
R2096:Ntng1 UTSW 3 109832555 missense probably damaging 0.99
R3739:Ntng1 UTSW 3 109934691 missense probably damaging 1.00
R3963:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4484:Ntng1 UTSW 3 110143808 unclassified probably benign
R4516:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4518:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4520:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4523:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4524:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4776:Ntng1 UTSW 3 109934713 missense probably damaging 1.00
R4817:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4827:Ntng1 UTSW 3 110135411 missense probably damaging 1.00
R4990:Ntng1 UTSW 3 110135261 critical splice donor site probably null
R5067:Ntng1 UTSW 3 110135345 missense possibly damaging 0.95
R5087:Ntng1 UTSW 3 110135329 nonsense probably null
R5196:Ntng1 UTSW 3 109934983 missense probably damaging 1.00
R5263:Ntng1 UTSW 3 109934872 missense probably damaging 0.99
R5743:Ntng1 UTSW 3 110135420 missense probably damaging 1.00
R6268:Ntng1 UTSW 3 109935035 missense probably damaging 1.00
R6292:Ntng1 UTSW 3 110143886 unclassified probably benign
R6419:Ntng1 UTSW 3 109782853 missense possibly damaging 0.95
R6898:Ntng1 UTSW 3 109872218 missense probably damaging 0.98
R7081:Ntng1 UTSW 3 109851789 missense probably benign 0.00
R7090:Ntng1 UTSW 3 109935180 nonsense probably null
R7134:Ntng1 UTSW 3 109935129 missense probably benign
R7302:Ntng1 UTSW 3 109832617 missense possibly damaging 0.94
R7353:Ntng1 UTSW 3 110135447 missense probably damaging 1.00
R7408:Ntng1 UTSW 3 109853082 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAAAGGGTCTCAAAATGCCTTG -3'
(R):5'- CACGGTCTTGGAAATCATTTGCACG -3'

Sequencing Primer
(F):5'- AGAATATACTTGCATAGTGGTGCTCC -3'
(R):5'- TCCACTTCGAGATCAAAGACAGG -3'
Posted On2013-05-09