Incidental Mutation 'R4746:Mia3'
ID356706
Institutional Source Beutler Lab
Gene Symbol Mia3
Ensembl Gene ENSMUSG00000056050
Gene Namemelanoma inhibitory activity 3
Synonyms9130229H14Rik, B230399H06Rik, LOC385255, A930039G15Rik, Tango
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4746 (G1)
Quality Score118
Status Not validated
Chromosome1
Chromosomal Location183326725-183369553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 183345220 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 26 (V26A)
Ref Sequence ENSEMBL: ENSMUSP00000104786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109158] [ENSMUST00000194807]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109158
AA Change: V26A

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104786
Gene: ENSMUSG00000056050
AA Change: V26A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
SCOP:d1fxkc_ 159 274 2e-4 SMART
low complexity region 281 294 N/A INTRINSIC
SCOP:d1fxkc_ 365 463 1e-3 SMART
low complexity region 482 498 N/A INTRINSIC
low complexity region 557 567 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 635 661 N/A INTRINSIC
low complexity region 665 680 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192090
Predicted Effect probably benign
Transcript: ENSMUST00000194807
SMART Domains Protein: ENSMUSP00000141957
Gene: ENSMUSG00000056050

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for the large isoform display complete perinatal lethality with impaired collagen secretion, intracellular collagen aggregates, short limbed dwarfism, and arrest of chondrocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Mia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1037:Mia3 UTSW 1 183357354 missense probably benign 0.06
R1489:Mia3 UTSW 1 183338674 missense probably benign
R1997:Mia3 UTSW 1 183344286 missense possibly damaging 0.72
R2261:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2263:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2334:Mia3 UTSW 1 183334402 critical splice donor site probably null
R3417:Mia3 UTSW 1 183362100 missense probably damaging 1.00
R3872:Mia3 UTSW 1 183356998 missense probably benign 0.04
R3943:Mia3 UTSW 1 183358783 missense possibly damaging 0.54
R4398:Mia3 UTSW 1 183330878 missense probably damaging 1.00
R4814:Mia3 UTSW 1 183332830 missense probably damaging 0.98
R4975:Mia3 UTSW 1 183331115 missense probably benign 0.02
R5104:Mia3 UTSW 1 183338132 missense probably damaging 0.98
R5174:Mia3 UTSW 1 183331493 nonsense probably null
R5272:Mia3 UTSW 1 183328270 nonsense probably null
R5445:Mia3 UTSW 1 183336022 missense probably benign 0.06
R5651:Mia3 UTSW 1 183358654 missense probably damaging 1.00
R5852:Mia3 UTSW 1 183332859 missense probably benign 0.01
R6246:Mia3 UTSW 1 183345277 missense probably damaging 0.99
R6565:Mia3 UTSW 1 183331485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACACACTGCCTGTCACTG -3'
(R):5'- AAGTTCATTCCCCGTGTCCG -3'

Sequencing Primer
(F):5'- CTGTGACAGTGCGCTCTGAAAAC -3'
(R):5'- TCCGCAGGAAGCGTCGTCT -3'
Posted On2015-11-11