Incidental Mutation 'R4746:Cbfa2t2'
ID356710
Institutional Source Beutler Lab
Gene Symbol Cbfa2t2
Ensembl Gene ENSMUSG00000038533
Gene Namecore-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)
SynonymsCbfa2t2h, MTGR1, C330013D05Rik
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154436481-154539356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 154523925 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 352 (M352L)
Ref Sequence ENSEMBL: ENSMUSP00000043087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045270] [ENSMUST00000099178] [ENSMUST00000109725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045270
AA Change: M352L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043087
Gene: ENSMUSG00000038533
AA Change: M352L

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1.3e-40 PFAM
PDB:2KYG|C 420 450 3e-7 PDB
Pfam:zf-MYND 498 534 1.4e-9 PFAM
low complexity region 573 588 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099178
AA Change: M352L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096782
Gene: ENSMUSG00000038533
AA Change: M352L

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 4.4e-40 PFAM
low complexity region 402 419 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109725
AA Change: M352L

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105347
Gene: ENSMUSG00000038533
AA Change: M352L

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1e-40 PFAM
Pfam:zf-MYND 497 533 3.3e-11 PFAM
low complexity region 572 587 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137526
AA Change: M57L
SMART Domains Protein: ENSMUSP00000118371
Gene: ENSMUSG00000038533
AA Change: M57L

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:NHR2 28 94 2e-41 PFAM
Pfam:zf-MYND 203 239 3.1e-10 PFAM
low complexity region 278 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154487
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are smaller and show reduced numbers of intestinal goblet, Paneth and enteroendocrine cells, small intestine inflammation, and strain dependent postnatal lethality. Homozygotes for a different null allele are infertile due to defects in primordial germ cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Cbfa2t2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cbfa2t2 APN 2 154528875 missense probably damaging 1.00
IGL01913:Cbfa2t2 APN 2 154517773 missense probably damaging 1.00
IGL02090:Cbfa2t2 APN 2 154531416 splice site probably benign
IGL02850:Cbfa2t2 APN 2 154535170 missense probably damaging 0.97
R0302:Cbfa2t2 UTSW 2 154534876 splice site probably benign
R0356:Cbfa2t2 UTSW 2 154531349 missense probably benign 0.03
R1218:Cbfa2t2 UTSW 2 154523919 missense probably benign 0.43
R1571:Cbfa2t2 UTSW 2 154500427 missense probably damaging 1.00
R1998:Cbfa2t2 UTSW 2 154504789 missense probably damaging 1.00
R2016:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2017:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2056:Cbfa2t2 UTSW 2 154535157 missense probably damaging 1.00
R3617:Cbfa2t2 UTSW 2 154436984 intron probably benign
R4299:Cbfa2t2 UTSW 2 154523928 missense probably damaging 1.00
R4969:Cbfa2t2 UTSW 2 154523980 missense probably damaging 1.00
R5058:Cbfa2t2 UTSW 2 154504745 missense probably damaging 1.00
R5109:Cbfa2t2 UTSW 2 154531373 missense probably damaging 1.00
R5381:Cbfa2t2 UTSW 2 154523929 missense probably damaging 1.00
R5573:Cbfa2t2 UTSW 2 154436862 intron probably benign
R5808:Cbfa2t2 UTSW 2 154517826 unclassified probably null
R5826:Cbfa2t2 UTSW 2 154500455 missense possibly damaging 0.90
R5977:Cbfa2t2 UTSW 2 154517777 missense probably damaging 1.00
R6052:Cbfa2t2 UTSW 2 154510581 missense probably damaging 1.00
R6842:Cbfa2t2 UTSW 2 154524045 missense probably benign 0.02
R6923:Cbfa2t2 UTSW 2 154534983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTCTGTATAAGTAACAAAGTCTA -3'
(R):5'- GTTGCTGAGAGAATCTGTACTCCC -3'

Sequencing Primer
(F):5'- AGTACTGGCTCCTCTTGTAGAAGAC -3'
(R):5'- AGAGAATCTGTACTCCCAGGGC -3'
Posted On2015-11-11