Incidental Mutation 'R4746:Gnb1'
ID356718
Institutional Source Beutler Lab
Gene Symbol Gnb1
Ensembl Gene ENSMUSG00000029064
Gene Nameguanine nucleotide binding protein (G protein), beta 1
Synonyms
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155491361-155559269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 155543074 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 104 (A104E)
Ref Sequence ENSEMBL: ENSMUSP00000135492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030940] [ENSMUST00000105616] [ENSMUST00000165335] [ENSMUST00000176411] [ENSMUST00000176637] [ENSMUST00000177094]
Predicted Effect probably damaging
Transcript: ENSMUST00000030940
AA Change: A104E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030940
Gene: ENSMUSG00000029064
AA Change: A104E

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105616
AA Change: A104E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101241
Gene: ENSMUSG00000029064
AA Change: A104E

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165335
AA Change: A104E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130123
Gene: ENSMUSG00000029064
AA Change: A104E

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175705
Predicted Effect probably damaging
Transcript: ENSMUST00000176411
AA Change: A104E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135769
Gene: ENSMUSG00000029064
AA Change: A104E

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
Blast:WD40 86 108 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176637
AA Change: A104E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135091
Gene: ENSMUSG00000029064
AA Change: A104E

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177094
AA Change: A104E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135492
Gene: ENSMUSG00000029064
AA Change: A104E

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Heterozygous null mice have an abnormal retina morphology with progressive degeneration. Mice homozygous for a mutation of this gene show prenatal or perinatal lethality with exencephaly and/or small brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Gnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Gnb1 APN 4 155543188 missense probably damaging 1.00
IGL02052:Gnb1 APN 4 155533691 splice site probably benign
IGL02164:Gnb1 APN 4 155557174 unclassified probably null
IGL02470:Gnb1 APN 4 155527513 splice site probably benign
IGL02928:Gnb1 APN 4 155553406 missense probably benign
IGL03293:Gnb1 APN 4 155540547 splice site probably benign
R0034:Gnb1 UTSW 4 155551689 missense probably benign 0.03
R0325:Gnb1 UTSW 4 155551683 missense probably benign 0.21
R1538:Gnb1 UTSW 4 155551714 missense probably benign 0.00
R3498:Gnb1 UTSW 4 155555026 missense possibly damaging 0.49
R4177:Gnb1 UTSW 4 155540656 intron probably benign
R4833:Gnb1 UTSW 4 155543067 missense possibly damaging 0.57
R5727:Gnb1 UTSW 4 155555102 missense probably benign 0.00
R6958:Gnb1 UTSW 4 155543194 critical splice donor site probably null
R7022:Gnb1 UTSW 4 155553456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTATGCCATCACACCTATC -3'
(R):5'- AGCAGTATACATCCCAGTTAGCAG -3'

Sequencing Primer
(F):5'- GAGACAGTTTTACTATGGAGCCC -3'
(R):5'- GTTAGCAGCTTACACCACTGG -3'
Posted On2015-11-11