Incidental Mutation 'R4746:Irs3'
ID356722
Institutional Source Beutler Lab
Gene Symbol Irs3
Ensembl Gene ENSMUSG00000047182
Gene Nameinsulin receptor substrate 3
Synonyms
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137643031-137645714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137643947 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 410 (S410P)
Ref Sequence ENSEMBL: ENSMUSP00000060844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031734] [ENSMUST00000057314] [ENSMUST00000166099] [ENSMUST00000175968] [ENSMUST00000176667] [ENSMUST00000177466] [ENSMUST00000177545] [ENSMUST00000196511]
Predicted Effect probably benign
Transcript: ENSMUST00000031734
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057314
AA Change: S410P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060844
Gene: ENSMUSG00000047182
AA Change: S410P

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166099
SMART Domains Protein: ENSMUSP00000127076
Gene: ENSMUSG00000079165

DomainStartEndE-ValueType
Pfam:SAP25 76 261 1.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175968
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176256
Predicted Effect probably benign
Transcript: ENSMUST00000176667
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176768
Predicted Effect probably benign
Transcript: ENSMUST00000176871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177354
Predicted Effect probably benign
Transcript: ENSMUST00000177466
Predicted Effect probably benign
Transcript: ENSMUST00000177545
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196511
SMART Domains Protein: ENSMUSP00000142730
Gene: ENSMUSG00000047182

DomainStartEndE-ValueType
PH 33 135 4.46e-11 SMART
IRS 159 272 1.18e-30 SMART
PTBI 159 272 7.23e-55 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and display no detectable abnormalities in growth or glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Irs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Irs3 APN 5 137645319 missense probably damaging 1.00
R0412:Irs3 UTSW 5 137643877 missense probably benign 0.04
R0544:Irs3 UTSW 5 137643839 missense probably benign 0.00
R1316:Irs3 UTSW 5 137644441 missense probably damaging 1.00
R1653:Irs3 UTSW 5 137644521 missense probably damaging 1.00
R2158:Irs3 UTSW 5 137644699 missense probably damaging 1.00
R3115:Irs3 UTSW 5 137643856 missense probably benign 0.01
R4971:Irs3 UTSW 5 137644492 missense probably damaging 1.00
R5304:Irs3 UTSW 5 137644741 missense probably benign
R5834:Irs3 UTSW 5 137644559 missense probably damaging 1.00
R5844:Irs3 UTSW 5 137644286 missense probably benign
R6770:Irs3 UTSW 5 137645213 missense possibly damaging 0.86
R7003:Irs3 UTSW 5 137645277 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACATAGTTGAGGCAGCTGTC -3'
(R):5'- ACTAGATCTGGGCGGGAACTAC -3'

Sequencing Primer
(F):5'- TTGAGGCAGCTGTCCAGAGAC -3'
(R):5'- TCAGGAATGACTATGTCCACATGG -3'
Posted On2015-11-11