Incidental Mutation 'R4746:Osbpl3'
ID356723
Institutional Source Beutler Lab
Gene Symbol Osbpl3
Ensembl Gene ENSMUSG00000029822
Gene Nameoxysterol binding protein-like 3
Synonyms6720421I08Rik, OSBP3, ORP3, 1200014M06Rik
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location50293330-50456201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50328674 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 434 (N434S)
Ref Sequence ENSEMBL: ENSMUSP00000110112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071728] [ENSMUST00000090019] [ENSMUST00000114466] [ENSMUST00000114468] [ENSMUST00000203907]
Predicted Effect probably damaging
Transcript: ENSMUST00000071728
AA Change: N398S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071643
Gene: ENSMUSG00000029822
AA Change: N398S

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 392 425 N/A INTRINSIC
Pfam:Oxysterol_BP 459 804 3.2e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090019
AA Change: N465S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087473
Gene: ENSMUSG00000029822
AA Change: N465S

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 4e-25 BLAST
low complexity region 459 492 N/A INTRINSIC
Pfam:Oxysterol_BP 526 870 3e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114466
AA Change: N429S

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110110
Gene: ENSMUSG00000029822
AA Change: N429S

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 3e-25 BLAST
low complexity region 423 456 N/A INTRINSIC
Pfam:Oxysterol_BP 490 835 3.5e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114468
AA Change: N434S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110112
Gene: ENSMUSG00000029822
AA Change: N434S

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 428 461 N/A INTRINSIC
Pfam:Oxysterol_BP 495 840 1.3e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133141
Predicted Effect unknown
Transcript: ENSMUST00000203907
AA Change: N214S
SMART Domains Protein: ENSMUSP00000145249
Gene: ENSMUSG00000029822
AA Change: N214S

DomainStartEndE-ValueType
Blast:PH 1 91 1e-57 BLAST
low complexity region 208 241 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. The encoded protein is involved in the regulation of cell adhesion and organization of the actin cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Osbpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Osbpl3 APN 6 50323068 missense probably damaging 1.00
IGL01784:Osbpl3 APN 6 50344922 missense probably damaging 1.00
IGL02221:Osbpl3 APN 6 50327367 unclassified probably benign
IGL02323:Osbpl3 APN 6 50346326 critical splice donor site probably null
IGL02894:Osbpl3 APN 6 50346332 missense possibly damaging 0.89
H8562:Osbpl3 UTSW 6 50347466 missense probably benign 0.09
PIT4283001:Osbpl3 UTSW 6 50346088 missense probably benign 0.01
R0226:Osbpl3 UTSW 6 50353008 missense probably damaging 1.00
R0416:Osbpl3 UTSW 6 50348018 missense probably benign
R0417:Osbpl3 UTSW 6 50348018 missense probably benign
R0601:Osbpl3 UTSW 6 50299403 missense probably benign 0.05
R0826:Osbpl3 UTSW 6 50346377 missense probably damaging 1.00
R1390:Osbpl3 UTSW 6 50308427 missense probably damaging 1.00
R1520:Osbpl3 UTSW 6 50346431 missense possibly damaging 0.75
R1603:Osbpl3 UTSW 6 50323093 missense probably damaging 1.00
R1678:Osbpl3 UTSW 6 50336213 critical splice donor site probably null
R1843:Osbpl3 UTSW 6 50370143 missense probably damaging 1.00
R1943:Osbpl3 UTSW 6 50320074 missense probably benign 0.16
R3435:Osbpl3 UTSW 6 50348070 missense possibly damaging 0.94
R3768:Osbpl3 UTSW 6 50348002 missense possibly damaging 0.64
R4751:Osbpl3 UTSW 6 50300997 missense possibly damaging 0.95
R4776:Osbpl3 UTSW 6 50300973 missense probably benign 0.01
R4814:Osbpl3 UTSW 6 50353000 missense probably damaging 1.00
R4841:Osbpl3 UTSW 6 50309376 missense probably damaging 1.00
R4881:Osbpl3 UTSW 6 50352784 missense possibly damaging 0.95
R4999:Osbpl3 UTSW 6 50336297 missense probably damaging 0.99
R5512:Osbpl3 UTSW 6 50309360 missense probably damaging 0.98
R6282:Osbpl3 UTSW 6 50348083 unclassified probably null
R6304:Osbpl3 UTSW 6 50312674 missense probably damaging 1.00
R6905:Osbpl3 UTSW 6 50351882 missense probably damaging 1.00
R7000:Osbpl3 UTSW 6 50297157 missense probably damaging 1.00
R7102:Osbpl3 UTSW 6 50320135 missense probably damaging 1.00
R7275:Osbpl3 UTSW 6 50346430 missense probably benign 0.02
Z1088:Osbpl3 UTSW 6 50297097 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGGGAAGGCACATTTTCCAC -3'
(R):5'- ATGCAGTGAAATCCTTTGTGTG -3'

Sequencing Primer
(F):5'- GGGAAGGCACATTTTCCACATTCTC -3'
(R):5'- CTCTTGAGTCTGTTCTAAATCCGTG -3'
Posted On2015-11-11