Incidental Mutation 'R4746:Olfr874'
ID356735
Institutional Source Beutler Lab
Gene Symbol Olfr874
Ensembl Gene ENSMUSG00000063350
Gene Nameolfactory receptor 874
SynonymsMOR161-2, GA_x6K02T2PVTD-31428850-31429782
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37745106-37748594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37746157 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 8 (V8L)
Ref Sequence ENSEMBL: ENSMUSP00000150088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115004] [ENSMUST00000216982]
Predicted Effect probably benign
Transcript: ENSMUST00000115004
AA Change: V8L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110656
Gene: ENSMUSG00000063350
AA Change: V8L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.9e-49 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216982
AA Change: V8L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Olfr874
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr874 APN 9 37746389 missense possibly damaging 0.89
IGL02349:Olfr874 APN 9 37746206 missense probably benign 0.03
IGL02799:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R0498:Olfr874 UTSW 9 37746254 missense probably damaging 1.00
R0690:Olfr874 UTSW 9 37746217 missense probably benign 0.01
R1053:Olfr874 UTSW 9 37746835 missense probably damaging 0.99
R1777:Olfr874 UTSW 9 37746311 missense possibly damaging 0.78
R1862:Olfr874 UTSW 9 37746968 missense probably benign
R1907:Olfr874 UTSW 9 37746433 missense probably benign 0.35
R4524:Olfr874 UTSW 9 37746866 missense possibly damaging 0.50
R4731:Olfr874 UTSW 9 37746535 missense probably benign 0.06
R4768:Olfr874 UTSW 9 37746881 missense probably damaging 1.00
R5130:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R5406:Olfr874 UTSW 9 37746647 missense probably benign 0.23
R5546:Olfr874 UTSW 9 37746524 missense probably benign 0.05
R5882:Olfr874 UTSW 9 37746632 missense probably benign 0.02
R5946:Olfr874 UTSW 9 37747034 missense probably damaging 0.99
R6226:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R6705:Olfr874 UTSW 9 37746734 missense possibly damaging 0.94
R6965:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTCAAACGGACTAACTTC -3'
(R):5'- ACCCTGAGTGTGAGATGATGTTC -3'

Sequencing Primer
(F):5'- ACGGACTAACTTCAGAATCTAAGAG -3'
(R):5'- TTTTGGGATGATAGTGGAGGAATAAC -3'
Posted On2015-11-11