Incidental Mutation 'R4746:Ckap4'
ID356741
Institutional Source Beutler Lab
Gene Symbol Ckap4
Ensembl Gene ENSMUSG00000046841
Gene Namecytoskeleton-associated protein 4
SynonymsCLIMP-63, 5630400A09Rik, P63
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location84526305-84534062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84533520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 116 (V116A)
Ref Sequence ENSEMBL: ENSMUSP00000130304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053871] [ENSMUST00000167671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053871
AA Change: V116A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050336
Gene: ENSMUSG00000046841
AA Change: V116A

DomainStartEndE-ValueType
low complexity region 36 59 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
internal_repeat_1 191 233 1.28e-5 PROSPERO
internal_repeat_1 269 311 1.28e-5 PROSPERO
coiled coil region 338 362 N/A INTRINSIC
coiled coil region 408 438 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
coiled coil region 537 575 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167671
AA Change: V116A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130304
Gene: ENSMUSG00000046841
AA Change: V116A

DomainStartEndE-ValueType
low complexity region 36 59 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
internal_repeat_1 191 233 1.28e-5 PROSPERO
internal_repeat_1 269 311 1.28e-5 PROSPERO
coiled coil region 338 362 N/A INTRINSIC
coiled coil region 408 438 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
coiled coil region 537 575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Ckap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Ckap4 APN 10 84528590 missense probably damaging 1.00
IGL03251:Ckap4 APN 10 84528605 missense probably damaging 1.00
PIT1430001:Ckap4 UTSW 10 84527766 missense probably damaging 0.99
R0866:Ckap4 UTSW 10 84527520 missense probably damaging 1.00
R1462:Ckap4 UTSW 10 84527567 missense probably damaging 1.00
R1462:Ckap4 UTSW 10 84527567 missense probably damaging 1.00
R1734:Ckap4 UTSW 10 84527874 missense probably benign
R2113:Ckap4 UTSW 10 84533523 missense possibly damaging 0.79
R3723:Ckap4 UTSW 10 84528392 missense probably damaging 1.00
R3958:Ckap4 UTSW 10 84528164 missense probably benign 0.01
R4735:Ckap4 UTSW 10 84533520 missense possibly damaging 0.69
R4857:Ckap4 UTSW 10 84533488 missense possibly damaging 0.73
R5308:Ckap4 UTSW 10 84528374 missense probably benign 0.01
R5333:Ckap4 UTSW 10 84527610 missense probably damaging 1.00
R5848:Ckap4 UTSW 10 84533490 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAACAAAGCGGGTCTGGGAC -3'
(R):5'- CGGCCAAACAAAGGGGCTC -3'

Sequencing Primer
(F):5'- ACTAGGGCGCTGGGGTC -3'
(R):5'- CCAAACAAAGGGGCTCCAAGG -3'
Posted On2015-11-11