Incidental Mutation 'R4746:Ppp2r3c'
ID356748
Institutional Source Beutler Lab
Gene Symbol Ppp2r3c
Ensembl Gene ENSMUSG00000021022
Gene Nameprotein phosphatase 2, regulatory subunit B'', gamma
Synonyms4930511A21Rik, G5pr, G4-1, 5730412A08Rik
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55278991-55302998 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 55302635 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410] [ENSMUST00000021411] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
AA Change: V6E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022
AA Change: V6E

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021411
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183475
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184249
Predicted Effect probably benign
Transcript: ENSMUST00000184766
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219809
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory subunit of the serine/threonine phosphatase, protein phosphatase 2. This protein is localized to both nuclear and cytoplasmic regions depending on cell cycle phase. Homozygous conditional knockout mice for this gene exhibit reduced numbers and impaired proliferation of immune system B cells. This protein may regulate the expression of the P-glycoprotein ATP-binding cassette transporter through its phosphatase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Znrd1as A T 17: 36,964,873 I116L probably benign Het
Other mutations in Ppp2r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ppp2r3c APN 12 55292498 splice site probably null
IGL01122:Ppp2r3c APN 12 55297802 missense probably benign 0.20
IGL01954:Ppp2r3c APN 12 55292568 missense probably damaging 1.00
IGL02939:Ppp2r3c APN 12 55298407 unclassified probably benign
R0045:Ppp2r3c UTSW 12 55293821 missense probably damaging 0.99
R0129:Ppp2r3c UTSW 12 55298422 missense probably damaging 0.96
R2411:Ppp2r3c UTSW 12 55298484 missense probably benign 0.19
R4468:Ppp2r3c UTSW 12 55297883 nonsense probably null
R5499:Ppp2r3c UTSW 12 55288626 missense probably benign 0.09
R5724:Ppp2r3c UTSW 12 55297832 missense probably benign 0.45
R6724:Ppp2r3c UTSW 12 55288496 missense probably benign 0.02
R6776:Ppp2r3c UTSW 12 55298467 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCCTTGGTAGATCTCCAAAGC -3'
(R):5'- CGGAATAGCTACAGCATCTTTCC -3'

Sequencing Primer
(F):5'- CTTGGTAGATCTCCAAAGCACATTC -3'
(R):5'- GAATAGCTACAGCATCTTTCCTTTCC -3'
Posted On2015-11-11