Incidental Mutation 'R4746:Znrd1as'
ID356759
Institutional Source Beutler Lab
Gene Symbol Znrd1as
Ensembl Gene ENSMUSG00000036214
Gene Namezinc ribbon domain containing 1, antisense
Synonyms1700022C21Rik
MMRRC Submission 041968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4746 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36958592-36965625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36964873 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 116 (I116L)
Ref Sequence ENSEMBL: ENSMUSP00000147556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040177] [ENSMUST00000173814] [ENSMUST00000209623]
Predicted Effect probably benign
Transcript: ENSMUST00000040177
AA Change: I46L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048695
Gene: ENSMUSG00000036214
AA Change: I46L

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
coiled coil region 163 195 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172672
Predicted Effect probably benign
Transcript: ENSMUST00000173814
SMART Domains Protein: ENSMUSP00000134016
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
low complexity region 145 157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185085
Predicted Effect probably benign
Transcript: ENSMUST00000209623
AA Change: I116L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,440,765 S180N probably benign Het
Atp5a1 G T 18: 77,778,742 G165V probably benign Het
Cbfa2t2 A C 2: 154,523,925 M352L possibly damaging Het
Ccser2 A T 14: 36,909,125 D98E probably damaging Het
Cfap20 A G 8: 95,422,056 probably null Het
Chuk A T 19: 44,088,771 C379S possibly damaging Het
Cic G A 7: 25,288,480 G1531E probably damaging Het
Ckap4 A G 10: 84,533,520 V116A possibly damaging Het
Cxcl13 A G 5: 95,959,897 K71E probably damaging Het
Dmxl2 A T 9: 54,451,796 I210N probably benign Het
Donson A C 16: 91,682,237 V397G probably damaging Het
Dpy19l1 C A 9: 24,450,670 V332L probably benign Het
Dsp T C 13: 38,195,104 S1343P possibly damaging Het
Egflam A G 15: 7,224,639 probably null Het
Eif2b4 A G 5: 31,187,653 I550T probably damaging Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gnb1 C A 4: 155,543,074 A104E probably damaging Het
Gnptg ATTGTTGATGATTT AT 17: 25,235,597 probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Igkv3-3 A T 6: 70,687,324 D50V probably benign Het
Irs3 A G 5: 137,643,947 S410P probably benign Het
Kif26b C T 1: 178,873,981 Q642* probably null Het
Klhl11 A T 11: 100,464,350 M215K probably benign Het
Lamc3 A G 2: 31,905,614 N337S possibly damaging Het
Lrrc55 G A 2: 85,196,170 A170V probably damaging Het
March3 A T 18: 56,776,072 W214R probably damaging Het
Megf11 A C 9: 64,508,745 T79P probably damaging Het
Mia3 A G 1: 183,345,220 V26A possibly damaging Het
Myrf A G 19: 10,218,591 F353S probably damaging Het
Obscn A G 11: 59,079,808 probably null Het
Ocstamp T C 2: 165,396,288 K352R probably benign Het
Olfr721-ps1 A T 14: 14,407,359 I46F probably benign Het
Olfr874 G T 9: 37,746,157 V8L probably benign Het
Osbpl3 T C 6: 50,328,674 N434S probably damaging Het
Pign A C 1: 105,585,024 L645V probably benign Het
Polr2a A G 11: 69,735,674 S1540P probably benign Het
Ppp2r3c A T 12: 55,302,635 probably null Het
Ptprf A G 4: 118,225,039 V414A possibly damaging Het
Pyroxd2 G A 19: 42,752,400 R22* probably null Het
Rab11fip2 G A 19: 59,937,110 A225V probably damaging Het
Ranbp2 C T 10: 58,492,670 A2836V probably damaging Het
Rimklb G A 6: 122,472,632 R28* probably null Het
Scyl3 G A 1: 163,949,251 R404Q probably damaging Het
Slc9a8 A T 2: 167,441,170 K79* probably null Het
Sowaha A T 11: 53,479,336 probably null Het
Tnk1 A G 11: 69,855,166 V311A probably damaging Het
Tnrc6a T A 7: 123,189,997 S1680T probably damaging Het
Tpp1 T C 7: 105,748,951 Y335C probably damaging Het
Ttc39b A G 4: 83,244,103 V308A probably benign Het
Ttll3 A C 6: 113,407,392 Q557P probably damaging Het
Ulk3 G A 9: 57,592,918 A266T probably benign Het
Wfdc6b C A 2: 164,617,433 C138* probably null Het
Other mutations in Znrd1as
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Znrd1as APN 17 36964921 missense probably damaging 0.99
R0347:Znrd1as UTSW 17 36965315 missense probably damaging 1.00
R0789:Znrd1as UTSW 17 36964960 missense probably damaging 1.00
R0993:Znrd1as UTSW 17 36965047 small deletion probably benign
R2110:Znrd1as UTSW 17 36965444 missense possibly damaging 0.47
R2866:Znrd1as UTSW 17 36965160 missense possibly damaging 0.91
R4224:Znrd1as UTSW 17 36958725 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGCTTTTGACTTAAGAGTTCTG -3'
(R):5'- GGCACCCAGTAATGCTGTTTC -3'

Sequencing Primer
(F):5'- GAGATTAAGATTCATGCTACCACTCC -3'
(R):5'- ACCCAGTAATGCTGTTTCTGTCTC -3'
Posted On2015-11-11