Incidental Mutation 'R4760:Ralgapa2'
ID356775
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
MMRRC Submission 041974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R4760 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146346749 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1371 (L1371Q)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect probably benign
Transcript: ENSMUST00000109986
AA Change: L1324Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: L1324Q

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131824
AA Change: L1286Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: L1286Q

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146307
AA Change: L312Q
SMART Domains Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: L312Q

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 285 290 N/A INTRINSIC
Pfam:Rap_GAP 690 830 4.9e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149499
AA Change: L956Q
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: L956Q

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228797
AA Change: L1371Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,721,305 M723K probably benign Het
A530053G22Rik A G 6: 60,402,101 noncoding transcript Het
Abcc2 A T 19: 43,810,481 Y512F probably benign Het
Adgrb1 T A 15: 74,571,463 I51N probably damaging Het
Adhfe1 A G 1: 9,563,523 Y332C probably damaging Het
Ambn C T 5: 88,467,707 L317F probably damaging Het
Amn1 T C 6: 149,185,113 Y17C probably benign Het
Apoa5 T C 9: 46,270,295 V223A probably damaging Het
BC048403 T C 10: 121,740,007 V11A probably damaging Het
Best3 A T 10: 117,024,794 H653L probably benign Het
Btnl2 C A 17: 34,363,195 S245Y probably damaging Het
Camk1d A G 2: 5,362,056 L116P probably damaging Het
Catsperg2 T A 7: 29,705,635 D698V probably damaging Het
Cd33 T C 7: 43,529,495 T307A probably benign Het
Cdk8 C T 5: 146,292,666 S230L probably benign Het
Cfap69 C T 5: 5,646,939 C119Y probably damaging Het
Chat T C 14: 32,453,737 N122S probably benign Het
Col20a1 A T 2: 180,984,403 probably benign Het
Cyp2j9 A T 4: 96,568,791 L481Q probably damaging Het
Dab1 A C 4: 104,732,145 S550R probably damaging Het
Dlgap2 A C 8: 14,773,380 Q533P probably damaging Het
Eif4g3 A T 4: 138,084,318 Q31L possibly damaging Het
Ets2 G A 16: 95,719,043 V438M probably damaging Het
Eva1c G A 16: 90,904,250 D258N probably benign Het
Fastkd2 A G 1: 63,745,886 H477R probably benign Het
Fga T G 3: 83,031,514 S399A probably benign Het
Fmo4 T A 1: 162,809,827 E32V probably damaging Het
Gm13083 G A 4: 143,617,231 R367K probably benign Het
Gm1840 G A 8: 5,640,473 noncoding transcript Het
Gm7204 T A 16: 48,218,688 noncoding transcript Het
Hhipl1 A G 12: 108,320,077 I548V probably damaging Het
Hsfy2 T C 1: 56,637,190 T63A probably benign Het
Igf2r A G 17: 12,703,465 V1254A possibly damaging Het
Ighv8-4 A T 12: 115,024,047 D110E probably damaging Het
Igkv14-130 T C 6: 67,791,462 S101P probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Ipo5 T C 14: 120,941,642 V779A probably benign Het
Itpr1 C T 6: 108,349,632 T105I probably benign Het
Kalrn T C 16: 34,198,487 M670V probably damaging Het
Kdm8 T A 7: 125,455,259 probably null Het
L3hypdh T C 12: 72,077,242 I281V probably benign Het
Lins1 T G 7: 66,714,687 probably benign Het
Map4k5 T A 12: 69,824,598 I517L possibly damaging Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mlkl C G 8: 111,319,716 probably null Het
Mllt1 A G 17: 56,902,630 M160T probably benign Het
Mmp15 G A 8: 95,368,196 A233T possibly damaging Het
Moxd2 C A 6: 40,891,603 T23N probably benign Het
Nop53 C A 7: 15,942,887 K100N probably benign Het
Nrg1 C A 8: 31,918,200 E2* probably null Het
Olfr654 T A 7: 104,588,489 H228Q probably benign Het
Pank4 A G 4: 154,974,634 D408G possibly damaging Het
Pcdhb10 T C 18: 37,411,942 W24R probably benign Het
Pcm1 C T 8: 41,287,738 T968I probably damaging Het
Pkib G T 10: 57,708,150 M19I probably benign Het
Ppy A G 11: 102,100,519 probably null Het
Prdx3 A C 19: 60,873,183 C39W possibly damaging Het
Qrfpr T G 3: 36,221,924 N106H probably benign Het
Rai14 G A 15: 10,575,690 T394M possibly damaging Het
Rbm12 A G 2: 156,097,128 L408P probably damaging Het
Rdx T C 9: 52,065,874 I141T probably benign Het
Reep1 T A 6: 71,708,001 V11E possibly damaging Het
Sall4 A G 2: 168,750,427 S936P probably damaging Het
Serac1 A G 17: 6,051,790 M403T possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc35g2 T G 9: 100,553,496 I41L probably benign Het
Slc39a12 G A 2: 14,400,323 S242N probably benign Het
Slc9a2 T A 1: 40,761,916 D535E probably damaging Het
Spata31d1a G T 13: 59,701,645 P890T probably damaging Het
Sync A G 4: 129,293,439 Q88R probably benign Het
Tdrp A G 8: 13,974,527 probably benign Het
Tg G T 15: 66,693,319 C1170F probably damaging Het
Tnks A T 8: 34,851,783 D781E probably benign Het
Tnp2 T A 16: 10,788,343 T87S possibly damaging Het
Tpp2 T C 1: 43,971,715 V554A probably benign Het
Traf3ip2 T C 10: 39,645,739 I431T probably damaging Het
Trav9d-4 A T 14: 52,983,801 H84L probably damaging Het
Vmn2r42 T A 7: 8,184,277 Y782F probably damaging Het
Vwf T C 6: 125,570,604 S231P probably damaging Het
Wdr83os A G 8: 85,081,867 S83G probably damaging Het
Wdr91 T A 6: 34,908,299 Q109L probably damaging Het
Znrf4 A G 17: 56,511,864 C148R possibly damaging Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146348454 missense probably benign
R7186:Ralgapa2 UTSW 2 146388486 splice site probably null
R7252:Ralgapa2 UTSW 2 146342751 critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146334568 missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146347126 missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146434856 missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146424667 missense probably damaging 1.00
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CACCTTGGCAACCACTGATTC -3'
(R):5'- ACTGAGTATACACAGGGACAATTCTG -3'

Sequencing Primer
(F):5'- TGGCAACCACTGATTCTCTACAG -3'
(R):5'- CACAGGGACAATTCTGTTTATTTTC -3'
Posted On2015-11-11