Incidental Mutation 'R4760:Ipo5'
ID356830
Institutional Source Beutler Lab
Gene Symbol Ipo5
Ensembl Gene ENSMUSG00000030662
Gene Nameimportin 5
SynonymsRanbp5, Kpnb3, 5730478E03Rik, IMB3, 1110011C18Rik
MMRRC Submission 041974-MU
Accession Numbers

Genbank: NM_023579; MGI: 1917822

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R4760 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location120911224-120947999 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120941642 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 779 (V779A)
Ref Sequence ENSEMBL: ENSMUSP00000032898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032898]
Predicted Effect probably benign
Transcript: ENSMUST00000032898
AA Change: V779A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: V779A

DomainStartEndE-ValueType
low complexity region 65 72 N/A INTRINSIC
Pfam:HEAT_2 359 467 3.3e-13 PFAM
Pfam:HEAT_EZ 372 426 3.7e-10 PFAM
Pfam:Vac14_Fab1_bd 373 430 3.8e-9 PFAM
Pfam:HEAT 400 430 4.2e-7 PFAM
Pfam:HEAT 906 936 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228277
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,721,305 M723K probably benign Het
A530053G22Rik A G 6: 60,402,101 noncoding transcript Het
Abcc2 A T 19: 43,810,481 Y512F probably benign Het
Adgrb1 T A 15: 74,571,463 I51N probably damaging Het
Adhfe1 A G 1: 9,563,523 Y332C probably damaging Het
Ambn C T 5: 88,467,707 L317F probably damaging Het
Amn1 T C 6: 149,185,113 Y17C probably benign Het
Apoa5 T C 9: 46,270,295 V223A probably damaging Het
BC048403 T C 10: 121,740,007 V11A probably damaging Het
Best3 A T 10: 117,024,794 H653L probably benign Het
Btnl2 C A 17: 34,363,195 S245Y probably damaging Het
Camk1d A G 2: 5,362,056 L116P probably damaging Het
Catsperg2 T A 7: 29,705,635 D698V probably damaging Het
Cd33 T C 7: 43,529,495 T307A probably benign Het
Cdk8 C T 5: 146,292,666 S230L probably benign Het
Cfap69 C T 5: 5,646,939 C119Y probably damaging Het
Chat T C 14: 32,453,737 N122S probably benign Het
Col20a1 A T 2: 180,984,403 probably benign Het
Cyp2j9 A T 4: 96,568,791 L481Q probably damaging Het
Dab1 A C 4: 104,732,145 S550R probably damaging Het
Dlgap2 A C 8: 14,773,380 Q533P probably damaging Het
Eif4g3 A T 4: 138,084,318 Q31L possibly damaging Het
Ets2 G A 16: 95,719,043 V438M probably damaging Het
Eva1c G A 16: 90,904,250 D258N probably benign Het
Fastkd2 A G 1: 63,745,886 H477R probably benign Het
Fga T G 3: 83,031,514 S399A probably benign Het
Fmo4 T A 1: 162,809,827 E32V probably damaging Het
Gm13083 G A 4: 143,617,231 R367K probably benign Het
Gm1840 G A 8: 5,640,473 noncoding transcript Het
Gm7204 T A 16: 48,218,688 noncoding transcript Het
Hhipl1 A G 12: 108,320,077 I548V probably damaging Het
Hsfy2 T C 1: 56,637,190 T63A probably benign Het
Igf2r A G 17: 12,703,465 V1254A possibly damaging Het
Ighv8-4 A T 12: 115,024,047 D110E probably damaging Het
Igkv14-130 T C 6: 67,791,462 S101P probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Itpr1 C T 6: 108,349,632 T105I probably benign Het
Kalrn T C 16: 34,198,487 M670V probably damaging Het
Kdm8 T A 7: 125,455,259 probably null Het
L3hypdh T C 12: 72,077,242 I281V probably benign Het
Lins1 T G 7: 66,714,687 probably benign Het
Map4k5 T A 12: 69,824,598 I517L possibly damaging Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mlkl C G 8: 111,319,716 probably null Het
Mllt1 A G 17: 56,902,630 M160T probably benign Het
Mmp15 G A 8: 95,368,196 A233T possibly damaging Het
Moxd2 C A 6: 40,891,603 T23N probably benign Het
Nop53 C A 7: 15,942,887 K100N probably benign Het
Nrg1 C A 8: 31,918,200 E2* probably null Het
Olfr654 T A 7: 104,588,489 H228Q probably benign Het
Pank4 A G 4: 154,974,634 D408G possibly damaging Het
Pcdhb10 T C 18: 37,411,942 W24R probably benign Het
Pcm1 C T 8: 41,287,738 T968I probably damaging Het
Pkib G T 10: 57,708,150 M19I probably benign Het
Ppy A G 11: 102,100,519 probably null Het
Prdx3 A C 19: 60,873,183 C39W possibly damaging Het
Qrfpr T G 3: 36,221,924 N106H probably benign Het
Rai14 G A 15: 10,575,690 T394M possibly damaging Het
Ralgapa2 A T 2: 146,346,749 L1371Q probably benign Het
Rbm12 A G 2: 156,097,128 L408P probably damaging Het
Rdx T C 9: 52,065,874 I141T probably benign Het
Reep1 T A 6: 71,708,001 V11E possibly damaging Het
Sall4 A G 2: 168,750,427 S936P probably damaging Het
Serac1 A G 17: 6,051,790 M403T possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc35g2 T G 9: 100,553,496 I41L probably benign Het
Slc39a12 G A 2: 14,400,323 S242N probably benign Het
Slc9a2 T A 1: 40,761,916 D535E probably damaging Het
Spata31d1a G T 13: 59,701,645 P890T probably damaging Het
Sync A G 4: 129,293,439 Q88R probably benign Het
Tdrp A G 8: 13,974,527 probably benign Het
Tg G T 15: 66,693,319 C1170F probably damaging Het
Tnks A T 8: 34,851,783 D781E probably benign Het
Tnp2 T A 16: 10,788,343 T87S possibly damaging Het
Tpp2 T C 1: 43,971,715 V554A probably benign Het
Traf3ip2 T C 10: 39,645,739 I431T probably damaging Het
Trav9d-4 A T 14: 52,983,801 H84L probably damaging Het
Vmn2r42 T A 7: 8,184,277 Y782F probably damaging Het
Vwf T C 6: 125,570,604 S231P probably damaging Het
Wdr83os A G 8: 85,081,867 S83G probably damaging Het
Wdr91 T A 6: 34,908,299 Q109L probably damaging Het
Znrf4 A G 17: 56,511,864 C148R possibly damaging Het
Other mutations in Ipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ipo5 APN 14 120928533 missense probably damaging 0.98
IGL01614:Ipo5 APN 14 120935095 missense probably benign 0.01
IGL01835:Ipo5 APN 14 120926238 missense probably benign 0.24
IGL02010:Ipo5 APN 14 120933377 missense probably benign 0.20
IGL02303:Ipo5 APN 14 120917383 missense probably benign
IGL02344:Ipo5 APN 14 120942779 splice site probably benign
IGL02657:Ipo5 APN 14 120943800 missense possibly damaging 0.47
IGL03094:Ipo5 APN 14 120943677 splice site probably benign
IGL03158:Ipo5 APN 14 120941891 splice site probably benign
IGL03309:Ipo5 APN 14 120920004 missense probably benign
IGL03392:Ipo5 APN 14 120942687 missense probably damaging 0.99
3-1:Ipo5 UTSW 14 120932936 missense probably benign 0.41
PIT4544001:Ipo5 UTSW 14 120928537 missense probably damaging 0.99
R0326:Ipo5 UTSW 14 120922223 missense probably benign 0.19
R0505:Ipo5 UTSW 14 120942733 missense possibly damaging 0.74
R0559:Ipo5 UTSW 14 120938641 missense probably damaging 1.00
R0590:Ipo5 UTSW 14 120944357 missense possibly damaging 0.76
R0969:Ipo5 UTSW 14 120944525 missense possibly damaging 0.64
R1450:Ipo5 UTSW 14 120944393 missense probably benign 0.04
R1672:Ipo5 UTSW 14 120933302 missense probably damaging 1.00
R2471:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R3508:Ipo5 UTSW 14 120939544 missense probably damaging 1.00
R3696:Ipo5 UTSW 14 120922162 missense probably benign 0.12
R4118:Ipo5 UTSW 14 120938661 missense probably benign 0.04
R4418:Ipo5 UTSW 14 120943893 missense possibly damaging 0.81
R4839:Ipo5 UTSW 14 120920038 missense probably benign 0.00
R4913:Ipo5 UTSW 14 120935086 missense probably damaging 1.00
R5326:Ipo5 UTSW 14 120926271 missense probably benign
R5339:Ipo5 UTSW 14 120943710 missense probably damaging 1.00
R5483:Ipo5 UTSW 14 120920038 missense probably benign 0.06
R5542:Ipo5 UTSW 14 120926271 missense probably benign
R5579:Ipo5 UTSW 14 120938613 missense probably benign 0.26
R5954:Ipo5 UTSW 14 120919984 missense probably damaging 1.00
R6948:Ipo5 UTSW 14 120923115 missense probably benign 0.00
R7365:Ipo5 UTSW 14 120920085 missense probably benign
W0251:Ipo5 UTSW 14 120938785 missense probably benign 0.17
X0062:Ipo5 UTSW 14 120941671 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGGTAGAAGTTGGTTACTGTCC -3'
(R):5'- TCAACCTGCTCGTCATAGTC -3'

Sequencing Primer
(F):5'- CTGGCTTTGAATCTGCAACTTGAC -3'
(R):5'- AACCTGCTCGTCATAGTCTTCATC -3'
Posted On2015-11-11