Incidental Mutation 'R4760:Tg'
ID356832
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Namethyroglobulin
SynonymsTgn
MMRRC Submission 041974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4760 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location66670753-66850721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66693319 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1170 (C1170F)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916]
Predicted Effect probably damaging
Transcript: ENSMUST00000065916
AA Change: C1170F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: C1170F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,721,305 M723K probably benign Het
A530053G22Rik A G 6: 60,402,101 noncoding transcript Het
Abcc2 A T 19: 43,810,481 Y512F probably benign Het
Adgrb1 T A 15: 74,571,463 I51N probably damaging Het
Adhfe1 A G 1: 9,563,523 Y332C probably damaging Het
Ambn C T 5: 88,467,707 L317F probably damaging Het
Amn1 T C 6: 149,185,113 Y17C probably benign Het
Apoa5 T C 9: 46,270,295 V223A probably damaging Het
BC048403 T C 10: 121,740,007 V11A probably damaging Het
Best3 A T 10: 117,024,794 H653L probably benign Het
Btnl2 C A 17: 34,363,195 S245Y probably damaging Het
Camk1d A G 2: 5,362,056 L116P probably damaging Het
Catsperg2 T A 7: 29,705,635 D698V probably damaging Het
Cd33 T C 7: 43,529,495 T307A probably benign Het
Cdk8 C T 5: 146,292,666 S230L probably benign Het
Cfap69 C T 5: 5,646,939 C119Y probably damaging Het
Chat T C 14: 32,453,737 N122S probably benign Het
Col20a1 A T 2: 180,984,403 probably benign Het
Cyp2j9 A T 4: 96,568,791 L481Q probably damaging Het
Dab1 A C 4: 104,732,145 S550R probably damaging Het
Dlgap2 A C 8: 14,773,380 Q533P probably damaging Het
Eif4g3 A T 4: 138,084,318 Q31L possibly damaging Het
Ets2 G A 16: 95,719,043 V438M probably damaging Het
Eva1c G A 16: 90,904,250 D258N probably benign Het
Fastkd2 A G 1: 63,745,886 H477R probably benign Het
Fga T G 3: 83,031,514 S399A probably benign Het
Fmo4 T A 1: 162,809,827 E32V probably damaging Het
Gm13083 G A 4: 143,617,231 R367K probably benign Het
Gm1840 G A 8: 5,640,473 noncoding transcript Het
Gm7204 T A 16: 48,218,688 noncoding transcript Het
Hhipl1 A G 12: 108,320,077 I548V probably damaging Het
Hsfy2 T C 1: 56,637,190 T63A probably benign Het
Igf2r A G 17: 12,703,465 V1254A possibly damaging Het
Ighv8-4 A T 12: 115,024,047 D110E probably damaging Het
Igkv14-130 T C 6: 67,791,462 S101P probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Ipo5 T C 14: 120,941,642 V779A probably benign Het
Itpr1 C T 6: 108,349,632 T105I probably benign Het
Kalrn T C 16: 34,198,487 M670V probably damaging Het
Kdm8 T A 7: 125,455,259 probably null Het
L3hypdh T C 12: 72,077,242 I281V probably benign Het
Lins1 T G 7: 66,714,687 probably benign Het
Map4k5 T A 12: 69,824,598 I517L possibly damaging Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mlkl C G 8: 111,319,716 probably null Het
Mllt1 A G 17: 56,902,630 M160T probably benign Het
Mmp15 G A 8: 95,368,196 A233T possibly damaging Het
Moxd2 C A 6: 40,891,603 T23N probably benign Het
Nop53 C A 7: 15,942,887 K100N probably benign Het
Nrg1 C A 8: 31,918,200 E2* probably null Het
Olfr654 T A 7: 104,588,489 H228Q probably benign Het
Pank4 A G 4: 154,974,634 D408G possibly damaging Het
Pcdhb10 T C 18: 37,411,942 W24R probably benign Het
Pcm1 C T 8: 41,287,738 T968I probably damaging Het
Pkib G T 10: 57,708,150 M19I probably benign Het
Ppy A G 11: 102,100,519 probably null Het
Prdx3 A C 19: 60,873,183 C39W possibly damaging Het
Qrfpr T G 3: 36,221,924 N106H probably benign Het
Rai14 G A 15: 10,575,690 T394M possibly damaging Het
Ralgapa2 A T 2: 146,346,749 L1371Q probably benign Het
Rbm12 A G 2: 156,097,128 L408P probably damaging Het
Rdx T C 9: 52,065,874 I141T probably benign Het
Reep1 T A 6: 71,708,001 V11E possibly damaging Het
Sall4 A G 2: 168,750,427 S936P probably damaging Het
Serac1 A G 17: 6,051,790 M403T possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc35g2 T G 9: 100,553,496 I41L probably benign Het
Slc39a12 G A 2: 14,400,323 S242N probably benign Het
Slc9a2 T A 1: 40,761,916 D535E probably damaging Het
Spata31d1a G T 13: 59,701,645 P890T probably damaging Het
Sync A G 4: 129,293,439 Q88R probably benign Het
Tdrp A G 8: 13,974,527 probably benign Het
Tnks A T 8: 34,851,783 D781E probably benign Het
Tnp2 T A 16: 10,788,343 T87S possibly damaging Het
Tpp2 T C 1: 43,971,715 V554A probably benign Het
Traf3ip2 T C 10: 39,645,739 I431T probably damaging Het
Trav9d-4 A T 14: 52,983,801 H84L probably damaging Het
Vmn2r42 T A 7: 8,184,277 Y782F probably damaging Het
Vwf T C 6: 125,570,604 S231P probably damaging Het
Wdr83os A G 8: 85,081,867 S83G probably damaging Het
Wdr91 T A 6: 34,908,299 Q109L probably damaging Het
Znrf4 A G 17: 56,511,864 C148R possibly damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
pipistrella UTSW 15 66696135 missense probably damaging 1.00
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense not run
R7529:Tg UTSW 15 66694768 missense not run
R7540:Tg UTSW 15 66689927 missense not run
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCACAGGTACCTTACAAGCAG -3'
(R):5'- ATCAGTCCAGGGTCTCAGAG -3'

Sequencing Primer
(F):5'- CTTACAAGCAGCTGCCTAGTAGG -3'
(R):5'- AGAGACCCCCTAGGACAGCTTG -3'
Posted On2015-11-11