Incidental Mutation 'R4761:Arhgap24'
ID356874
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
MMRRC Submission 042402-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4761 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 102664214 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112854]
Predicted Effect probably benign
Transcript: ENSMUST00000073302
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126125
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,067,198 V210D probably damaging Het
4931409K22Rik A G 5: 24,551,983 V232A probably benign Het
9630041A04Rik A G 9: 101,942,966 D195G possibly damaging Het
Abcc8 G A 7: 46,113,075 R1221C probably damaging Het
Adra1a T A 14: 66,727,431 probably null Het
Akr1c6 A T 13: 4,447,011 M98L probably benign Het
Alpk3 A G 7: 81,104,168 Q1632R probably damaging Het
Atp8b5 A G 4: 43,308,504 *40W probably null Het
Bdkrb2 A T 12: 105,588,278 M17L probably benign Het
C4bp T C 1: 130,653,421 K117R possibly damaging Het
Cacng3 A T 7: 122,768,664 T256S probably benign Het
Cep63 T C 9: 102,587,041 probably benign Het
Ces2b T A 8: 104,836,561 probably null Het
Col12a1 T A 9: 79,657,310 D1696V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcst1 A T 3: 89,357,553 M296K possibly damaging Het
Diexf T C 1: 193,113,922 Y145C probably damaging Het
Ehbp1l1 G A 19: 5,719,847 P476L possibly damaging Het
Enpp1 A G 10: 24,641,951 V858A possibly damaging Het
Ermp1 T A 19: 29,646,256 E55D probably benign Het
Eya1 G A 1: 14,302,821 L25F probably damaging Het
Foxn2 T A 17: 88,462,708 probably null Het
Gabrb3 A T 7: 57,765,502 T107S probably damaging Het
Gm21964 A T 8: 110,110,121 D213V probably damaging Het
Gm26678 A T 3: 54,633,143 noncoding transcript Het
Gm5415 A T 1: 32,546,507 S107R possibly damaging Het
Gm7897 G T 1: 173,829,970 noncoding transcript Het
Gm9789 A T 16: 89,158,027 Y8F unknown Het
Gsta3 A T 1: 21,260,157 T78S probably benign Het
H2-Ab1 A G 17: 34,267,500 N178D probably damaging Het
Herc6 G A 6: 57,662,900 V1000I probably benign Het
Hrnr A C 3: 93,322,755 K100T probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Kmt2a C A 9: 44,849,124 R509L probably damaging Het
Lefty1 T A 1: 180,937,625 C253S probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Mfsd9 T C 1: 40,774,475 K227E possibly damaging Het
Mrps2 C G 2: 28,469,934 H268D probably benign Het
Mrps27 T A 13: 99,412,231 S292T probably benign Het
Ncaph T C 2: 127,106,116 D683G probably benign Het
Nlrc3 A T 16: 3,963,650 S632T probably damaging Het
Nsun6 T C 2: 15,030,061 T198A possibly damaging Het
Oasl2 C T 5: 114,899,775 H78Y probably benign Het
Olfr921 T C 9: 38,775,837 V194A probably benign Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdgfrb C A 18: 61,079,700 S892Y probably damaging Het
Por T G 5: 135,725,930 probably benign Het
Ppp2r5e A T 12: 75,593,261 V22D possibly damaging Het
Prcp A G 7: 92,917,725 probably null Het
Ptchd3 A T 11: 121,836,398 N366I possibly damaging Het
Rprd1b A G 2: 158,047,970 E4G probably damaging Het
Serpinb6d C A 13: 33,671,267 S308Y probably damaging Het
Slc12a7 T C 13: 73,813,589 V1026A probably benign Het
Slc17a7 G A 7: 45,170,984 V313I probably benign Het
Slc35c1 T A 2: 92,458,823 M113L probably damaging Het
Smgc A G 15: 91,845,514 T178A possibly damaging Het
Spef2 A T 15: 9,652,954 W914R probably damaging Het
Srfbp1 C A 18: 52,488,566 P233Q probably damaging Het
Swt1 A C 1: 151,401,102 C508G probably benign Het
Tex22 T C 12: 113,088,766 V148A possibly damaging Het
Tpd52 G A 3: 8,963,873 P37L probably damaging Het
Vmn1r197 A T 13: 22,328,004 M32L probably benign Het
Vmn2r100 T C 17: 19,521,368 F114S possibly damaging Het
Xdh T A 17: 73,910,267 I669F possibly damaging Het
Zfp940 G A 7: 29,846,153 R110C probably benign Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 intron probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 intron probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016
Predicted Primers PCR Primer
(F):5'- TTGCAGACACCGAGCAATTC -3'
(R):5'- GAGTCTCGTGGGCAACTGAATC -3'

Sequencing Primer
(F):5'- GCAATTCAGATGCTCAATGCTGC -3'
(R):5'- AATCATTCTGCAGCCGTGAG -3'
Posted On2015-11-11