Incidental Mutation 'R4761:Olfr921'
ID356887
Institutional Source Beutler Lab
Gene Symbol Olfr921
Ensembl Gene ENSMUSG00000049926
Gene Nameolfactory receptor 921
SynonymsMOR165-8, GA_x6K02T2PVTD-32478047-32478988
MMRRC Submission 042402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.018) question?
Stock #R4761 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38773068-38779021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38775837 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 194 (V194A)
Ref Sequence ENSEMBL: ENSMUSP00000150844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071681] [ENSMUST00000213958] [ENSMUST00000217114]
Predicted Effect probably benign
Transcript: ENSMUST00000062124
AA Change: V194A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051879
Gene: ENSMUSG00000049926
AA Change: V194A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-48 PFAM
Pfam:7tm_1 41 290 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071681
AA Change: V194A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071604
Gene: ENSMUSG00000049926
AA Change: V194A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-51 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213958
AA Change: V194A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000217114
AA Change: V194A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,067,198 V210D probably damaging Het
4931409K22Rik A G 5: 24,551,983 V232A probably benign Het
9630041A04Rik A G 9: 101,942,966 D195G possibly damaging Het
Abcc8 G A 7: 46,113,075 R1221C probably damaging Het
Adra1a T A 14: 66,727,431 probably null Het
Akr1c6 A T 13: 4,447,011 M98L probably benign Het
Alpk3 A G 7: 81,104,168 Q1632R probably damaging Het
Arhgap24 G T 5: 102,664,214 probably benign Het
Atp8b5 A G 4: 43,308,504 *40W probably null Het
Bdkrb2 A T 12: 105,588,278 M17L probably benign Het
C4bp T C 1: 130,653,421 K117R possibly damaging Het
Cacng3 A T 7: 122,768,664 T256S probably benign Het
Cep63 T C 9: 102,587,041 probably benign Het
Ces2b T A 8: 104,836,561 probably null Het
Col12a1 T A 9: 79,657,310 D1696V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcst1 A T 3: 89,357,553 M296K possibly damaging Het
Diexf T C 1: 193,113,922 Y145C probably damaging Het
Ehbp1l1 G A 19: 5,719,847 P476L possibly damaging Het
Enpp1 A G 10: 24,641,951 V858A possibly damaging Het
Ermp1 T A 19: 29,646,256 E55D probably benign Het
Eya1 G A 1: 14,302,821 L25F probably damaging Het
Foxn2 T A 17: 88,462,708 probably null Het
Gabrb3 A T 7: 57,765,502 T107S probably damaging Het
Gm21964 A T 8: 110,110,121 D213V probably damaging Het
Gm26678 A T 3: 54,633,143 noncoding transcript Het
Gm5415 A T 1: 32,546,507 S107R possibly damaging Het
Gm7897 G T 1: 173,829,970 noncoding transcript Het
Gm9789 A T 16: 89,158,027 Y8F unknown Het
Gsta3 A T 1: 21,260,157 T78S probably benign Het
H2-Ab1 A G 17: 34,267,500 N178D probably damaging Het
Herc6 G A 6: 57,662,900 V1000I probably benign Het
Hrnr A C 3: 93,322,755 K100T probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Kmt2a C A 9: 44,849,124 R509L probably damaging Het
Lefty1 T A 1: 180,937,625 C253S probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Mfsd9 T C 1: 40,774,475 K227E possibly damaging Het
Mrps2 C G 2: 28,469,934 H268D probably benign Het
Mrps27 T A 13: 99,412,231 S292T probably benign Het
Ncaph T C 2: 127,106,116 D683G probably benign Het
Nlrc3 A T 16: 3,963,650 S632T probably damaging Het
Nsun6 T C 2: 15,030,061 T198A possibly damaging Het
Oasl2 C T 5: 114,899,775 H78Y probably benign Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdgfrb C A 18: 61,079,700 S892Y probably damaging Het
Por T G 5: 135,725,930 probably benign Het
Ppp2r5e A T 12: 75,593,261 V22D possibly damaging Het
Prcp A G 7: 92,917,725 probably null Het
Ptchd3 A T 11: 121,836,398 N366I possibly damaging Het
Rprd1b A G 2: 158,047,970 E4G probably damaging Het
Serpinb6d C A 13: 33,671,267 S308Y probably damaging Het
Slc12a7 T C 13: 73,813,589 V1026A probably benign Het
Slc17a7 G A 7: 45,170,984 V313I probably benign Het
Slc35c1 T A 2: 92,458,823 M113L probably damaging Het
Smgc A G 15: 91,845,514 T178A possibly damaging Het
Spef2 A T 15: 9,652,954 W914R probably damaging Het
Srfbp1 C A 18: 52,488,566 P233Q probably damaging Het
Swt1 A C 1: 151,401,102 C508G probably benign Het
Tex22 T C 12: 113,088,766 V148A possibly damaging Het
Tpd52 G A 3: 8,963,873 P37L probably damaging Het
Vmn1r197 A T 13: 22,328,004 M32L probably benign Het
Vmn2r100 T C 17: 19,521,368 F114S possibly damaging Het
Xdh T A 17: 73,910,267 I669F possibly damaging Het
Zfp940 G A 7: 29,846,153 R110C probably benign Het
Other mutations in Olfr921
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr921 APN 9 38775812 nonsense probably null
IGL01016:Olfr921 APN 9 38775441 missense probably damaging 0.99
IGL01391:Olfr921 APN 9 38775530 missense probably damaging 1.00
IGL01451:Olfr921 APN 9 38775929 missense probably benign 0.04
IGL02250:Olfr921 APN 9 38775554 missense probably damaging 1.00
R0026:Olfr921 UTSW 9 38775596 missense probably benign 0.01
R0334:Olfr921 UTSW 9 38775239 critical splice acceptor site probably null
R0655:Olfr921 UTSW 9 38775554 nonsense probably null
R1024:Olfr921 UTSW 9 38775335 missense probably damaging 0.97
R3522:Olfr921 UTSW 9 38775720 missense possibly damaging 0.67
R3967:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3968:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3969:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R4796:Olfr921 UTSW 9 38775374 missense probably benign 0.15
R4880:Olfr921 UTSW 9 38775547 nonsense probably null
R5237:Olfr921 UTSW 9 38775956 missense probably damaging 1.00
R5756:Olfr921 UTSW 9 38775258 start codon destroyed probably null 1.00
R6230:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R6487:Olfr921 UTSW 9 38775435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCCCCAAGGGTGTGTTC -3'
(R):5'- CCTTGATCAATAGATACAGCAGAGG -3'

Sequencing Primer
(F):5'- CCCAAGGGTGTGTTCTTATCTCATG -3'
(R):5'- GGTTTCAGGTACATGAATCCAC -3'
Posted On2015-11-11