Incidental Mutation 'R4762:Cfap54'
ID356972
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission 042403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R4762 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationsplice site (9 bp from exon)
DNA Base Change (assembly) A to C at 93061453 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000212902]
Predicted Effect probably null
Transcript: ENSMUST00000020200
SMART Domains Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 643 3e-298 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168080
Predicted Effect probably null
Transcript: ENSMUST00000168110
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168617
SMART Domains Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 148 4.3e-22 PFAM
Pfam:DUF4486 145 595 1.6e-244 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212902
Meta Mutation Damage Score 0.6052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (86/86)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik T C 1: 158,969,556 noncoding transcript Het
2310030G06Rik T C 9: 50,740,667 E87G probably damaging Het
Aknad1 A T 3: 108,775,231 H541L possibly damaging Het
Asb15 A G 6: 24,567,237 E519G possibly damaging Het
Atad2 T C 15: 58,108,362 D373G probably benign Het
Bbs12 G A 3: 37,320,380 V326M probably damaging Het
Birc6 T C 17: 74,629,489 I2617T probably damaging Het
Brca2 A G 5: 150,531,116 T115A probably benign Het
Casz1 T C 4: 148,938,981 L495P probably damaging Het
Ccdc30 T A 4: 119,333,588 I481F probably damaging Het
Cept1 A T 3: 106,539,361 Y56* probably null Het
Cyp2j8 G T 4: 96,470,649 D344E probably damaging Het
Dido1 A T 2: 180,689,575 W27R probably damaging Het
Disp3 A G 4: 148,272,118 I95T probably damaging Het
Engase G T 11: 118,487,094 V237F possibly damaging Het
Ephb6 G A 6: 41,618,160 E703K probably damaging Het
Fnip1 T A 11: 54,466,171 F35L probably damaging Het
Fnip1 A T 11: 54,499,526 T440S probably benign Het
Fras1 T A 5: 96,731,618 H2431Q probably benign Het
Fzd4 A T 7: 89,407,716 T324S probably damaging Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm14124 T A 2: 150,267,629 C80S possibly damaging Het
Gpr84 A T 15: 103,308,600 V350E probably damaging Het
Gsto2 T C 19: 47,874,873 Y63H probably damaging Het
Gtpbp6 T C 5: 110,104,320 T449A probably damaging Het
Herc2 G A 7: 56,170,640 V2876I probably benign Het
Hnrnpa3 A G 2: 75,662,007 I152V possibly damaging Het
Hpse2 T C 19: 42,789,071 D552G possibly damaging Het
Itfg1 A G 8: 85,732,441 V460A possibly damaging Het
Jhy G A 9: 40,911,198 A548V probably benign Het
Klhl21 T A 4: 152,009,811 L290Q possibly damaging Het
Knl1 T C 2: 119,071,936 S1373P probably benign Het
Kpna2 A C 11: 106,990,259 M426R probably benign Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Lpar1 T G 4: 58,437,346 H361P possibly damaging Het
Macf1 T C 4: 123,455,444 T2100A probably benign Het
Mfsd13b T C 7: 120,991,326 F97L probably damaging Het
Mmp15 A G 8: 95,372,330 K595R probably benign Het
Mrps25 C T 6: 92,175,104 G145D probably damaging Het
Muc4 T A 16: 32,753,625 probably benign Het
Napa A T 7: 16,115,271 K245N probably benign Het
Olfr1082 A G 2: 86,594,037 S264P possibly damaging Het
Olfr1284 G A 2: 111,379,737 V246M probably damaging Het
Olfr1285 T A 2: 111,408,880 noncoding transcript Het
Olfr1386 A T 11: 49,470,285 I45F probably damaging Het
Olfr221 T A 14: 52,035,464 I216F possibly damaging Het
Olfr292 A G 7: 86,695,121 T222A probably benign Het
Olfr796 C A 10: 129,608,174 M102I probably damaging Het
Olfr898 A G 9: 38,349,281 Y60C probably damaging Het
Papss2 A T 19: 32,638,978 T195S probably benign Het
Parp4 T A 14: 56,610,810 H694Q probably damaging Het
Patj C T 4: 98,405,570 R20* probably null Het
Pcdhgb8 T A 18: 37,762,366 V163E probably damaging Het
Pkd2l1 T A 19: 44,155,621 T338S probably benign Het
Ppargc1b A T 18: 61,311,257 S278R possibly damaging Het
Ppl T C 16: 5,088,982 T1150A probably benign Het
Ralgds A G 2: 28,552,152 D858G probably damaging Het
Rassf2 G A 2: 132,002,863 probably benign Het
Ring1 T C 17: 34,021,997 probably benign Het
Rusc1 A C 3: 89,091,642 S278A probably benign Het
Samd9l T C 6: 3,375,623 N546S probably benign Het
Sct A C 7: 141,279,041 probably benign Het
Slc22a12 T G 19: 6,538,444 H348P probably benign Het
Slc25a15 A G 8: 22,383,232 S143P probably damaging Het
Slc26a11 C A 11: 119,356,831 probably benign Het
Slc6a20b A G 9: 123,598,560 M428T probably damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Smoc1 G T 12: 81,167,651 W269L probably damaging Het
Sox5 C T 6: 143,861,383 probably null Het
Sp100 A G 1: 85,701,458 *483W probably null Het
Sptbn5 T A 2: 120,077,222 noncoding transcript Het
Sun5 G A 2: 153,865,363 R132* probably null Het
Tedc2 A G 17: 24,216,380 V345A probably benign Het
Tlr6 T A 5: 64,954,396 R389S probably benign Het
Ttc17 G T 2: 94,371,768 H396Q probably damaging Het
Ttn A G 2: 76,943,039 S2340P probably damaging Het
Vmn1r219 C T 13: 23,162,829 Q63* probably null Het
Vmn1r224 A G 17: 20,419,640 T160A possibly damaging Het
Vmn2r11 T C 5: 109,047,570 N630S probably damaging Het
Zfp747 A G 7: 127,374,326 V224A possibly damaging Het
Zfp804b T C 5: 6,772,250 N271S probably benign Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATGCCTGTCAGTGTTAATAATCCC -3'
(R):5'- AAACCCCAGGAGAGCGTTAG -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- TAGCTTGGGGCATGGCAGAC -3'
Posted On2015-11-11