Incidental Mutation 'R4763:Disc1'
ID357033
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Namedisrupted in schizophrenia 1
Synonyms
MMRRC Submission 042404-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R4763 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125054195-125261858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125124538 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 387 (G387D)
Ref Sequence ENSEMBL: ENSMUSP00000112929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953]
Predicted Effect probably damaging
Transcript: ENSMUST00000074562
AA Change: G389D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: G389D

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075730
AA Change: G389D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: G389D

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098311
AA Change: G389D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: G389D

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115885
AA Change: G389D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: G389D

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117658
AA Change: G389D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: G389D

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118942
AA Change: G389D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: G389D

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121953
AA Change: G387D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: G387D

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik A G 9: 98,187,123 noncoding transcript Het
Abhd2 A G 7: 79,360,131 E418G probably benign Het
Acox2 G T 14: 8,241,334 H593N possibly damaging Het
Adam17 A G 12: 21,334,015 Y495H probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arhgap44 A G 11: 65,039,165 I240T probably damaging Het
Atp2c1 T C 9: 105,418,567 T653A probably damaging Het
Atxn7l1 G A 12: 33,358,878 probably benign Het
Cacng8 T C 7: 3,414,992 V220A probably damaging Het
Card14 A T 11: 119,343,175 S864C probably damaging Het
Cfap58 C T 19: 47,983,506 A625V probably damaging Het
Cfap61 T C 2: 146,017,367 V425A probably benign Het
Cfap73 A G 5: 120,630,229 F155L probably damaging Het
Cntrl G T 2: 35,175,551 R2235L probably damaging Het
Cxxc1 A G 18: 74,219,413 K355E probably damaging Het
Dpf2 T C 19: 5,902,452 Y286C probably damaging Het
E2f7 A T 10: 110,780,849 K650M probably damaging Het
Fbln2 C T 6: 91,270,000 S1027F probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gm6811 A G 17: 21,093,847 noncoding transcript Het
Gtf2i T C 5: 134,255,964 K409E probably damaging Het
Hamp T A 7: 30,942,564 R55S probably damaging Het
Heatr1 C T 13: 12,430,930 T1596I possibly damaging Het
Hells T C 19: 38,957,199 V601A probably damaging Het
Ighv5-8 A G 12: 113,653,541 S34P probably damaging Het
Lig4 T C 8: 9,972,955 D275G probably damaging Het
Med6 T C 12: 81,582,661 D59G probably damaging Het
Men1 T C 19: 6,335,072 probably null Het
Mlec G A 5: 115,157,913 A41V unknown Het
Ncoa1 G A 12: 4,275,297 T927I probably damaging Het
Neb T A 2: 52,237,040 K378* probably null Het
Neb T A 2: 52,326,720 K148* probably null Het
Olfr1287 T A 2: 111,449,678 C179* probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr498 G A 7: 108,466,186 M287I probably benign Het
Olfr943 A G 9: 39,184,960 T261A probably benign Het
Parp10 C T 15: 76,233,427 V920M probably damaging Het
Parp6 C A 9: 59,631,365 P241H probably damaging Het
Pcyox1l A G 18: 61,697,779 Y341H probably benign Het
Pfas A T 11: 68,990,194 D1080E possibly damaging Het
Pi4kb G T 3: 95,004,409 probably benign Het
Piwil2 C T 14: 70,376,778 V846M probably damaging Het
Pkd1l2 A G 8: 117,019,429 F1941L probably damaging Het
Pot1b G A 17: 55,695,160 T138M possibly damaging Het
Ppp4r1 T C 17: 65,835,110 I720T possibly damaging Het
Prr12 A G 7: 45,047,695 L932S unknown Het
Rnaseh2a T A 8: 84,965,392 E84V probably benign Het
Rpl18a G A 8: 70,895,686 R118C probably benign Het
Rprm C A 2: 54,085,216 C30F possibly damaging Het
Sbf2 G T 7: 110,420,917 L579I probably damaging Het
Sfn C A 4: 133,601,345 R142L probably benign Het
St8sia6 T C 2: 13,672,530 K159E probably damaging Het
Sugct A T 13: 17,662,787 F86L probably damaging Het
Tldc1 A G 8: 119,768,383 V212A probably benign Het
Tmcc3 T C 10: 94,579,311 S292P probably damaging Het
Tmem33 A T 5: 67,286,136 I219F probably benign Het
Trav8-1 C A 14: 53,470,035 T44K possibly damaging Het
U2surp A G 9: 95,511,791 probably benign Het
Use1 T C 8: 71,367,308 L25P probably damaging Het
Vmn1r221 G T 13: 23,217,788 noncoding transcript Het
Vmn1r50 C T 6: 90,108,080 T269I probably benign Het
Washc3 A G 10: 88,219,323 D125G probably damaging Het
Zfp142 G A 1: 74,576,512 H278Y probably damaging Het
Zfp418 A G 7: 7,181,445 N136D possibly damaging Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125088275 missense probably benign 0.27
IGL01319:Disc1 APN 8 125087891 missense probably damaging 0.99
IGL02001:Disc1 APN 8 125251042 missense probably damaging 0.97
IGL02403:Disc1 APN 8 125135519 splice site probably benign
IGL02445:Disc1 APN 8 125148403 splice site probably benign
R0334:Disc1 UTSW 8 125261097 synonymous probably null
R0992:Disc1 UTSW 8 125088042 missense probably damaging 1.00
R1654:Disc1 UTSW 8 125148465 missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125124610 missense probably benign 0.05
R3154:Disc1 UTSW 8 125135304 missense probably damaging 1.00
R3947:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3948:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3949:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R4051:Disc1 UTSW 8 125148425 missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125148459 missense probably damaging 1.00
R4691:Disc1 UTSW 8 125148447 missense possibly damaging 0.90
R4825:Disc1 UTSW 8 125135302 missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125124550 nonsense probably null
R5087:Disc1 UTSW 8 125132160 missense probably benign
R5383:Disc1 UTSW 8 125135457 missense probably damaging 1.00
R5827:Disc1 UTSW 8 125135365 missense probably damaging 1.00
R5828:Disc1 UTSW 8 125251024 missense probably damaging 0.99
R6431:Disc1 UTSW 8 125135389 missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125218105 missense probably benign 0.00
R6794:Disc1 UTSW 8 125087775 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGAGGCTGGTAACCTACAGC -3'
(R):5'- TCCCAGCTCTTGACTGCATG -3'

Sequencing Primer
(F):5'- TGGTAACCTACAGCCCTGC -3'
(R):5'- TGCATGGCAGTGGGGAAG -3'
Posted On2015-11-11