Incidental Mutation 'R4764:Abcb1a'
ID357087
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1A
SynonymsPgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8660077-8748575 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 8715732 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
PDB Structure
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000047753
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145232
Meta Mutation Damage Score 0.6248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8686257 missense probably benign 0.01
IGL00898:Abcb1a APN 5 8733690 missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8732388 missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8674687 missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8702550 missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8698637 missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8715065 critical splice donor site probably null
IGL01820:Abcb1a APN 5 8715896 splice site probably benign
IGL02499:Abcb1a APN 5 8726807 missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8723245 splice site probably null
IGL02954:Abcb1a APN 5 8732341 missense probably benign 0.00
IGL03018:Abcb1a APN 5 8702451 missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8714887 missense probably benign 0.00
IGL03292:Abcb1a APN 5 8715827 missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8694153 missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8713281 missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8698535 missense probably benign 0.01
R0595:Abcb1a UTSW 5 8740417 missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8698539 missense probably benign 0.13
R0811:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8674856 splice site probably benign
R0948:Abcb1a UTSW 5 8740621 splice site probably null
R1292:Abcb1a UTSW 5 8713343 missense probably benign 0.00
R1318:Abcb1a UTSW 5 8701621 missense probably benign 0.31
R1459:Abcb1a UTSW 5 8702920 missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8686300 critical splice donor site probably null
R1514:Abcb1a UTSW 5 8674791 missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8713202 missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8738747 missense probably benign 0.30
R2844:Abcb1a UTSW 5 8686164 missense probably benign 0.02
R3709:Abcb1a UTSW 5 8738738 missense probably benign 0.03
R3755:Abcb1a UTSW 5 8747403 missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8715068 splice site probably null
R4401:Abcb1a UTSW 5 8702390 missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8719981 splice site probably benign
R4539:Abcb1a UTSW 5 8715793 missense probably benign
R4635:Abcb1a UTSW 5 8714927 missense probably benign
R4740:Abcb1a UTSW 5 8702280 critical splice donor site probably null
R4757:Abcb1a UTSW 5 8737632 missense probably damaging 0.99
R4792:Abcb1a UTSW 5 8746657 critical splice donor site probably null
R4829:Abcb1a UTSW 5 8723214 missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8737773 critical splice donor site probably null
R5140:Abcb1a UTSW 5 8702154 missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8714937 missense probably benign
R5355:Abcb1a UTSW 5 8726873 missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8702946 missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8674818 missense probably benign
R5557:Abcb1a UTSW 5 8714949 missense probably benign 0.01
R5572:Abcb1a UTSW 5 8715108 intron probably null
R5702:Abcb1a UTSW 5 8737752 missense probably benign 0.15
R5753:Abcb1a UTSW 5 8723160 missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8683426 missense probably benign 0.01
R5895:Abcb1a UTSW 5 8702216 missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8719030 missense probably benign 0.01
R6555:Abcb1a UTSW 5 8702468 missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8732364 missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8701628 missense probably benign 0.28
R7000:Abcb1a UTSW 5 8702823 missense probably benign 0.19
R7102:Abcb1a UTSW 5 8694072 missense probably benign 0.01
R7172:Abcb1a UTSW 5 8702399 missense probably benign 0.00
R7313:Abcb1a UTSW 5 8723187 missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8715771 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTGTTCCAGAAACCAAAATGAC -3'
(R):5'- AATGGATGTCATCACTTACCCC -3'

Sequencing Primer
(F):5'- CACCACTTGGATGGTGAAAGC -3'
(R):5'- TGGATGTCATCACTTACCCCTACAAC -3'
Posted On2015-11-11