Incidental Mutation 'R4764:Chst8'
ID357094
Institutional Source Beutler Lab
Gene Symbol Chst8
Ensembl Gene ENSMUSG00000060402
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Synonyms1500011J21Rik, GalNAc4ST-1
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location34674468-34812711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34675724 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 230 (D230G)
Ref Sequence ENSEMBL: ENSMUSP00000145646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078686] [ENSMUST00000154629] [ENSMUST00000205259]
Predicted Effect probably damaging
Transcript: ENSMUST00000078686
AA Change: D230G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077752
Gene: ENSMUSG00000060402
AA Change: D230G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
Pfam:Sulfotransfer_2 175 410 4.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135295
Predicted Effect probably benign
Transcript: ENSMUST00000154629
SMART Domains Protein: ENSMUSP00000123498
Gene: ENSMUSG00000060402

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205259
AA Change: D230G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is predominantly expressed in the pituitary gland, and is localized to the golgi membrane. This protein catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. It is responsible for sulfation of GalNAc on luteinizing hormone (LH), which is required for production of the sex hormones. Mice lacking this enzyme, exhibit increased levels of circulating LH, and precocious sexual maturation of both male and female mice. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Male mice homozygous for a null allele show higher luteinizing hormone and testosterone levels, early sexual maturation and enlarged seminal vesicles; females show higher LH, estrogen and progesterone levels, early sexual maturation, enlarged uteri, a prolonged estrous cycle and increased fecundity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Chst8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02078:Chst8 APN 7 34675334 missense possibly damaging 0.66
R0306:Chst8 UTSW 7 34675298 missense probably benign
R1445:Chst8 UTSW 7 34748168 missense possibly damaging 0.95
R1510:Chst8 UTSW 7 34675268 missense probably benign 0.00
R2022:Chst8 UTSW 7 34675164 missense possibly damaging 0.92
R2248:Chst8 UTSW 7 34748172 missense probably damaging 0.98
R2262:Chst8 UTSW 7 34676010 missense probably benign
R4463:Chst8 UTSW 7 34675220 missense probably damaging 0.98
R5379:Chst8 UTSW 7 34675854 missense probably damaging 1.00
R5521:Chst8 UTSW 7 34675245 missense probably benign
R5679:Chst8 UTSW 7 34675304 missense probably damaging 1.00
R6412:Chst8 UTSW 7 34676079 missense probably benign 0.03
R7247:Chst8 UTSW 7 34675936 missense probably damaging 1.00
R7282:Chst8 UTSW 7 34748203 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATGGTCCCAGTGGATGTC -3'
(R):5'- CTAAATACAGGGCCAGCAGCAG -3'

Sequencing Primer
(F):5'- GAACTCGGGGAACTGCACAC -3'
(R):5'- AGCCGCAGAGCTGTCACTC -3'
Posted On2015-11-11