Incidental Mutation 'R4764:Bptf'
ID357122
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Namebromodomain PHD finger transcription factor
Synonyms9430093H17Rik, Falz
MMRRC Submission 042405-MU
Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107033081-107132127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107043694 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2851 (V2851E)
Ref Sequence ENSEMBL: ENSMUSP00000102373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763] [ENSMUST00000133317] [ENSMUST00000208369]
Predicted Effect probably damaging
Transcript: ENSMUST00000057892
AA Change: V2799E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: V2799E

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106762
AA Change: V2851E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: V2851E

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106763
AA Change: V2914E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: V2914E

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133317
SMART Domains Protein: ENSMUSP00000118875
Gene: ENSMUSG00000040481

DomainStartEndE-ValueType
low complexity region 57 94 N/A INTRINSIC
low complexity region 107 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147816
Predicted Effect probably benign
Transcript: ENSMUST00000208369
AA Change: V217E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 107055279 missense possibly damaging 0.88
IGL00664:Bptf APN 11 107077665 missense possibly damaging 0.78
IGL00705:Bptf APN 11 107095708 splice site probably benign
IGL00796:Bptf APN 11 107054550 missense probably damaging 1.00
IGL00834:Bptf APN 11 107073928 missense possibly damaging 0.59
IGL01155:Bptf APN 11 107080727 missense probably damaging 1.00
IGL01314:Bptf APN 11 107054853 missense probably damaging 1.00
IGL01371:Bptf APN 11 107055907 missense probably benign 0.00
IGL01567:Bptf APN 11 107058774 missense probably damaging 1.00
IGL01794:Bptf APN 11 107053221 critical splice donor site probably null
IGL02108:Bptf APN 11 107074988 missense probably benign 0.45
IGL02367:Bptf APN 11 107073352 missense probably benign
IGL02437:Bptf APN 11 107074695 missense probably benign 0.00
IGL02589:Bptf APN 11 107111531 missense possibly damaging 0.92
IGL02897:Bptf APN 11 107047121 missense probably damaging 1.00
IGL02935:Bptf APN 11 107080799 missense probably damaging 1.00
IGL02954:Bptf APN 11 107054749 missense possibly damaging 0.89
IGL02982:Bptf APN 11 107076674 missense probably damaging 1.00
IGL03109:Bptf APN 11 107061701 missense possibly damaging 0.53
IGL03265:Bptf APN 11 107054628 missense probably benign 0.00
IGL03403:Bptf APN 11 107099733 missense possibly damaging 0.51
IGL03097:Bptf UTSW 11 107077680 missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 107054788 missense probably damaging 0.98
R0066:Bptf UTSW 11 107062136 missense possibly damaging 0.90
R0157:Bptf UTSW 11 107074658 missense possibly damaging 0.89
R0320:Bptf UTSW 11 107072819 missense probably damaging 1.00
R0328:Bptf UTSW 11 107047127 missense probably damaging 1.00
R0402:Bptf UTSW 11 107074114 missense probably damaging 1.00
R0482:Bptf UTSW 11 107081262 missense probably benign 0.13
R0574:Bptf UTSW 11 107076527 missense probably damaging 1.00
R0598:Bptf UTSW 11 107072965 missense probably damaging 0.99
R0599:Bptf UTSW 11 107068382 missense probably damaging 1.00
R0601:Bptf UTSW 11 107061692 missense probably benign 0.04
R0744:Bptf UTSW 11 107110812 critical splice donor site probably null
R0836:Bptf UTSW 11 107110812 critical splice donor site probably null
R0885:Bptf UTSW 11 107043791 missense probably damaging 1.00
R1070:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1252:Bptf UTSW 11 107073251 missense probably benign 0.00
R1370:Bptf UTSW 11 107047094 missense probably damaging 0.99
R1428:Bptf UTSW 11 107073047 missense probably damaging 0.99
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1742:Bptf UTSW 11 107110951 missense probably damaging 1.00
R1816:Bptf UTSW 11 107060579 missense probably damaging 1.00
R1858:Bptf UTSW 11 107073301 missense probably benign 0.00
R1989:Bptf UTSW 11 107074826 missense probably damaging 1.00
R2253:Bptf UTSW 11 107111322 missense probably damaging 1.00
R2392:Bptf UTSW 11 107072747 missense probably damaging 1.00
R2431:Bptf UTSW 11 107047240 missense possibly damaging 0.48
R3022:Bptf UTSW 11 107111637 critical splice acceptor site probably null
R3161:Bptf UTSW 11 107074476 missense probably damaging 1.00
R3686:Bptf UTSW 11 107074198 missense probably benign 0.25
R3687:Bptf UTSW 11 107074198 missense probably benign 0.25
R3688:Bptf UTSW 11 107074198 missense probably benign 0.25
R3787:Bptf UTSW 11 107073827 missense probably damaging 1.00
R3834:Bptf UTSW 11 107073857 missense probably benign 0.05
R3885:Bptf UTSW 11 107074513 missense probably damaging 0.97
R4090:Bptf UTSW 11 107081523 missense probably damaging 0.99
R4398:Bptf UTSW 11 107110844 missense probably damaging 1.00
R4437:Bptf UTSW 11 107074474 missense possibly damaging 0.59
R4514:Bptf UTSW 11 107077692 missense probably damaging 1.00
R4565:Bptf UTSW 11 107073010 missense probably damaging 1.00
R4715:Bptf UTSW 11 107047181 missense probably damaging 1.00
R4748:Bptf UTSW 11 107095880 missense probably damaging 0.96
R4885:Bptf UTSW 11 107074648 missense probably benign 0.39
R4901:Bptf UTSW 11 107110860 nonsense probably null
R4995:Bptf UTSW 11 107054565 missense probably damaging 0.98
R5057:Bptf UTSW 11 107082528 missense probably damaging 0.98
R5120:Bptf UTSW 11 107073385 missense probably damaging 0.99
R5320:Bptf UTSW 11 107081367 nonsense probably null
R5329:Bptf UTSW 11 107073295 missense probably benign 0.06
R5418:Bptf UTSW 11 107111294 missense probably damaging 1.00
R5461:Bptf UTSW 11 107061764 missense probably damaging 1.00
R5664:Bptf UTSW 11 107073699 missense probably benign 0.01
R5718:Bptf UTSW 11 107111434 missense probably damaging 1.00
R5774:Bptf UTSW 11 107111137 missense probably damaging 1.00
R5851:Bptf UTSW 11 107110862 missense probably damaging 1.00
R5930:Bptf UTSW 11 107073196 missense probably damaging 1.00
R5949:Bptf UTSW 11 107111089 missense probably damaging 0.99
R5975:Bptf UTSW 11 107035864 utr 3 prime probably benign
R6027:Bptf UTSW 11 107074945 missense probably damaging 1.00
R6128:Bptf UTSW 11 107074690 missense possibly damaging 0.87
R6337:Bptf UTSW 11 107058779 missense possibly damaging 0.89
R6407:Bptf UTSW 11 107111126 missense probably damaging 1.00
R6470:Bptf UTSW 11 107072767 missense probably damaging 1.00
R6487:Bptf UTSW 11 107077726 missense probably damaging 0.99
R6501:Bptf UTSW 11 107077683 missense probably null 1.00
R6755:Bptf UTSW 11 107047256 missense probably benign 0.27
R6861:Bptf UTSW 11 107062565 missense probably damaging 1.00
R6866:Bptf UTSW 11 107073580 missense probably damaging 1.00
R6879:Bptf UTSW 11 107042690 missense probably benign 0.32
R6927:Bptf UTSW 11 107054595 missense probably damaging 1.00
R6944:Bptf UTSW 11 107080823 missense probably damaging 1.00
R7082:Bptf UTSW 11 107086747 missense probably benign 0.00
R7136:Bptf UTSW 11 107099715 missense probably damaging 1.00
R7162:Bptf UTSW 11 107043631 critical splice donor site probably null
R7171:Bptf UTSW 11 107131407 missense unknown
R7193:Bptf UTSW 11 107054809 nonsense probably null
R7210:Bptf UTSW 11 107054464 nonsense probably null
R7221:Bptf UTSW 11 107054832 missense probably damaging 1.00
R7316:Bptf UTSW 11 107073109 missense probably damaging 1.00
R7316:Bptf UTSW 11 107110914 nonsense probably null
R7422:Bptf UTSW 11 107060558 missense probably damaging 1.00
R7454:Bptf UTSW 11 107044640 missense probably benign 0.03
Z1088:Bptf UTSW 11 107074582 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTAAACTTCATGTCACCGGC -3'
(R):5'- AGAAGCAGCCAGTCCTTTG -3'

Sequencing Primer
(F):5'- AGAGGTGCCCTTTGTCCAG -3'
(R):5'- GGCCTCACATTTCCATTTTGG -3'
Posted On2015-11-11