Incidental Mutation 'R4764:Bdp1'
ID357128
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission 042405-MU
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100056267 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1353 (L1353P)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably damaging
Transcript: ENSMUST00000038104
AA Change: L1353P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: L1353P

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably damaging
Transcript: ENSMUST00000109379
AA Change: L1353P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: L1353P

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTGGTCTACCTTATCAGTTAGAC -3'
(R):5'- CTAGAAGTAGAAGTGCTGCGC -3'

Sequencing Primer
(F):5'- GGAAGTATCACTGTTTACCC -3'
(R):5'- TACCCACACAGAGTGGTT -3'
Posted On2015-11-11