Mutagenetix > Incidental Mutation

Incidental Mutation 'R4764:Trio'

357134

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

042405-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4764 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730737-28025934 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 27732624 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 3086 (R3086*)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000090247
AA Change: R3086*

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: R3086*

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226713

Predicted Effect

probably benign
Transcript: ENSMUST00000227030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228054

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	G	5: 146,122,029 (GRCm39)	S18R	probably benign	Het
2010315B03Rik	A	C	9: 124,056,396 (GRCm39)	V176G	probably benign	Het
Abcb1a	T	A	5: 8,765,732 (GRCm39)		probably null	Het
Acad11	C	A	9: 103,953,076 (GRCm39)	P102T	probably damaging	Het
Aggf1	T	A	13: 95,501,221 (GRCm39)	D387V	probably damaging	Het
Akr1c13	G	A	13: 4,248,496 (GRCm39)	V234I	probably benign	Het
Alg5	A	G	3: 54,653,894 (GRCm39)	Y210C	possibly damaging	Het
Arl8a	C	A	1: 135,074,837 (GRCm39)	A41E	probably benign	Het
Axin1	C	A	17: 26,392,730 (GRCm39)	T337K	possibly damaging	Het
Bdp1	A	G	13: 100,192,775 (GRCm39)	L1353P	probably damaging	Het
Bptf	A	T	11: 106,934,520 (GRCm39)	V2851E	probably damaging	Het
C9	A	T	15: 6,489,124 (GRCm39)	E160D	probably damaging	Het
Cbx6	T	C	15: 79,712,881 (GRCm39)	D182G	probably damaging	Het
Cep57l1	T	C	10: 41,597,678 (GRCm39)	R242G	possibly damaging	Het
Chst8	T	C	7: 34,375,149 (GRCm39)	D230G	probably damaging	Het
Col3a1	A	C	1: 45,385,270 (GRCm39)	D129A	probably damaging	Het
Cst12	A	G	2: 148,631,393 (GRCm39)	E38G	possibly damaging	Het
Disp1	G	T	1: 182,869,660 (GRCm39)	A920E	probably damaging	Het
Dtna	T	G	18: 23,668,206 (GRCm39)		probably null	Het
Elp3	T	A	14: 65,820,378 (GRCm39)	H97L	probably damaging	Het
Exoc8	A	G	8: 125,624,314 (GRCm39)	F18L	possibly damaging	Het
Extl3	T	C	14: 65,314,769 (GRCm39)	T138A	probably benign	Het
Foxi2	G	T	7: 135,012,396 (GRCm39)	G95C	probably damaging	Het
Foxj2	G	T	6: 122,810,230 (GRCm39)	Q196H	probably benign	Het
Frem1	A	T	4: 82,907,426 (GRCm39)	D811E	probably damaging	Het
Frmd4a	A	T	2: 4,608,259 (GRCm39)	E709V	probably damaging	Het
Fscn3	T	A	6: 28,436,200 (GRCm39)	*499K	probably null	Het
Galc	C	T	12: 98,209,003 (GRCm39)	G217D	possibly damaging	Het
Gm5592	G	T	7: 40,865,542 (GRCm39)		probably benign	Het
Gm57858	T	G	3: 36,064,809 (GRCm39)	*521C	probably null	Het
Hnrnpul1	A	G	7: 25,442,436 (GRCm39)	S269P	probably benign	Het
Hrh1	T	C	6: 114,457,496 (GRCm39)	V259A	probably benign	Het
Lef1	T	C	3: 130,978,382 (GRCm39)	S167P	probably benign	Het
Mtf2	T	C	5: 108,241,218 (GRCm39)	I248T	probably benign	Het
Muc2	C	T	7: 141,299,345 (GRCm39)	T130M	possibly damaging	Het
Myo16	T	C	8: 10,485,880 (GRCm39)	F653S	probably damaging	Het
Myo1e	T	C	9: 70,250,417 (GRCm39)		probably null	Het
Myo5a	G	T	9: 75,023,618 (GRCm39)		probably benign	Het
Nlrp1b	T	A	11: 71,073,489 (GRCm39)	D118V	probably damaging	Het
Npat	T	C	9: 53,483,920 (GRCm39)	F1412S	probably damaging	Het
Onecut3	G	T	10: 80,331,541 (GRCm39)	A234S	unknown	Het
Or1ad1	G	A	11: 50,875,602 (GRCm39)	E25K	probably benign	Het
Or8b37	T	G	9: 37,959,436 (GRCm39)	L306R	probably benign	Het
Osbpl6	T	A	2: 76,376,344 (GRCm39)	I73K	probably damaging	Het
Otog	C	T	7: 45,937,943 (GRCm39)	T1884I	probably benign	Het
Pax6	C	A	2: 105,526,847 (GRCm39)	P251Q	probably benign	Het
Pias4	A	G	10: 80,999,868 (GRCm39)	Y62H	possibly damaging	Het
Pknox1	T	A	17: 31,809,687 (GRCm39)	V97D	possibly damaging	Het
Plekhf1	A	G	7: 37,921,022 (GRCm39)	V182A	probably damaging	Het
Plscr4	T	C	9: 92,366,833 (GRCm39)	V149A	probably damaging	Het
Polr2l	A	T	7: 141,053,309 (GRCm39)	L35Q	probably damaging	Het
Ppp3ca	T	C	3: 136,596,250 (GRCm39)	I305T	probably damaging	Het
Ptprg	G	A	14: 12,122,068 (GRCm38)	A311T	probably benign	Het
Raet1e	T	G	10: 22,057,231 (GRCm39)	I185R	probably damaging	Het
Rims1	A	C	1: 22,518,543 (GRCm39)	V520G	probably damaging	Het
Rp1	A	T	1: 4,416,101 (GRCm39)	D1670E	probably damaging	Het
Rps6ka1	A	T	4: 133,587,868 (GRCm39)	I352N	probably damaging	Het
Rtp3	T	C	9: 110,816,418 (GRCm39)		probably benign	Het
Ryr3	T	A	2: 112,563,376 (GRCm39)		probably null	Het
Sall3	A	G	18: 81,017,691 (GRCm39)	V79A	probably damaging	Het
Sdsl	C	T	5: 120,600,119 (GRCm39)	V93M	probably damaging	Het
Slc7a13	A	G	4: 19,819,390 (GRCm39)	N197D	probably benign	Het
Slit1	T	A	19: 41,709,483 (GRCm39)	R137*	probably null	Het
Stxbp5	C	A	10: 9,646,367 (GRCm39)	R115L	probably damaging	Het
Tcea1	G	A	1: 4,965,167 (GRCm39)	R290H	probably damaging	Het
Tmem132e	A	T	11: 82,325,338 (GRCm39)	T113S	probably damaging	Het
Tpp1	A	T	7: 105,398,458 (GRCm39)	I286N	probably damaging	Het
Usp22	T	A	11: 61,051,462 (GRCm39)	N294Y	probably damaging	Het
Usp44	T	A	10: 93,681,933 (GRCm39)	S128T	probably benign	Het
Zc3h7b	T	C	15: 81,653,384 (GRCm39)		probably null	Het
Zfhx2	T	C	14: 55,304,372 (GRCm39)	Y1204C	possibly damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27,912,829 (GRCm39)	splice site	probably benign
IGL01011:Trio	APN	15	27,736,575 (GRCm39)	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27,773,093 (GRCm39)	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27,818,253 (GRCm39)	splice site	probably benign
IGL01147:Trio	APN	15	27,881,406 (GRCm39)	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27,749,867 (GRCm39)	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27,905,409 (GRCm39)	missense	probably benign	0.42
IGL01352:Trio	APN	15	27,901,315 (GRCm39)	missense	probably benign	0.01
IGL01366:Trio	APN	15	27,732,954 (GRCm39)	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27,838,861 (GRCm39)	splice site	probably benign
IGL01454:Trio	APN	15	27,833,071 (GRCm39)	missense	probably benign	0.32
IGL01695:Trio	APN	15	27,773,087 (GRCm39)	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27,764,112 (GRCm39)	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27,846,896 (GRCm39)	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27,741,119 (GRCm39)	missense	probably benign	0.12
IGL01991:Trio	APN	15	27,871,360 (GRCm39)	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27,744,244 (GRCm39)	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27,744,139 (GRCm39)	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27,902,647 (GRCm39)	missense	probably benign	0.24
IGL02304:Trio	APN	15	27,735,522 (GRCm39)	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27,847,476 (GRCm39)	nonsense	probably null
IGL02508:Trio	APN	15	27,818,190 (GRCm39)	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27,845,016 (GRCm39)	splice site	probably benign
IGL02617:Trio	APN	15	27,841,935 (GRCm39)	splice site	probably benign
IGL02675:Trio	APN	15	27,768,125 (GRCm39)	unclassified	probably benign
IGL02817:Trio	APN	15	27,902,967 (GRCm39)	missense	probably benign	0.01
IGL02993:Trio	APN	15	27,830,325 (GRCm39)	splice site	probably benign
IGL03007:Trio	APN	15	27,902,828 (GRCm39)	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27,832,097 (GRCm39)	splice site	probably benign
IGL03225:Trio	APN	15	27,902,781 (GRCm39)	missense	probably benign	0.30
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0302:Trio	UTSW	15	27,902,603 (GRCm39)	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27,767,993 (GRCm39)	missense	probably benign	0.00
R0506:Trio	UTSW	15	27,855,049 (GRCm39)	missense	probably benign	0.12
R0564:Trio	UTSW	15	27,805,908 (GRCm39)	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27,831,485 (GRCm39)	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27,732,980 (GRCm39)	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27,741,336 (GRCm39)	critical splice donor site	probably null
R1018:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27,898,000 (GRCm39)	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27,753,890 (GRCm39)	splice site	probably benign
R1488:Trio	UTSW	15	27,741,053 (GRCm39)	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27,732,726 (GRCm39)	missense	probably benign	0.28
R1531:Trio	UTSW	15	27,833,071 (GRCm39)	missense	probably benign	0.32
R1640:Trio	UTSW	15	27,833,130 (GRCm39)	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27,758,433 (GRCm39)	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27,744,232 (GRCm39)	splice site	probably null
R1780:Trio	UTSW	15	27,744,124 (GRCm39)	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27,841,842 (GRCm39)	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27,748,426 (GRCm39)	missense	probably benign
R1817:Trio	UTSW	15	27,742,581 (GRCm39)	nonsense	probably null
R1853:Trio	UTSW	15	27,756,622 (GRCm39)	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27,742,466 (GRCm39)	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27,833,142 (GRCm39)	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27,732,977 (GRCm39)	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27,774,013 (GRCm39)	missense	probably damaging	1.00
R2025:Trio	UTSW	15	27,744,223 (GRCm39)	missense	probably damaging	0.99
R2050:Trio	UTSW	15	27,852,031 (GRCm39)	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27,824,061 (GRCm39)	splice site	probably null
R2913:Trio	UTSW	15	27,854,998 (GRCm39)	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27,805,862 (GRCm39)	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27,833,156 (GRCm39)	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27,744,187 (GRCm39)	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27,749,883 (GRCm39)	nonsense	probably null
R4370:Trio	UTSW	15	27,748,423 (GRCm39)	nonsense	probably null
R4547:Trio	UTSW	15	27,819,068 (GRCm39)	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27,773,084 (GRCm39)	small deletion	probably benign
R4620:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27,752,875 (GRCm39)	splice site	probably null
R4775:Trio	UTSW	15	27,881,428 (GRCm39)	nonsense	probably null
R4942:Trio	UTSW	15	27,752,811 (GRCm39)	missense	probably benign	0.21
R5004:Trio	UTSW	15	27,755,264 (GRCm39)	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27,754,115 (GRCm39)	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27,902,686 (GRCm39)	missense	probably benign	0.00
R5186:Trio	UTSW	15	27,898,077 (GRCm39)	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27,748,372 (GRCm39)	missense	probably benign	0.02
R5344:Trio	UTSW	15	27,735,618 (GRCm39)	missense	probably benign	0.12
R5407:Trio	UTSW	15	27,844,892 (GRCm39)	splice site	probably null
R5442:Trio	UTSW	15	27,856,280 (GRCm39)	missense	probably benign	0.04
R5617:Trio	UTSW	15	27,902,834 (GRCm39)	missense	probably benign
R5778:Trio	UTSW	15	27,856,250 (GRCm39)	missense	probably benign	0.33
R5986:Trio	UTSW	15	27,852,019 (GRCm39)	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27,891,545 (GRCm39)	missense	probably benign	0.10
R6011:Trio	UTSW	15	27,735,631 (GRCm39)	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27,891,465 (GRCm39)	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27,818,157 (GRCm39)	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27,744,038 (GRCm39)	critical splice donor site	probably null
R6387:Trio	UTSW	15	27,752,825 (GRCm39)	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27,902,997 (GRCm39)	missense	probably benign	0.02
R6478:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R6528:Trio	UTSW	15	27,805,956 (GRCm39)	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27,855,082 (GRCm39)	missense	probably benign	0.00
R6825:Trio	UTSW	15	27,889,394 (GRCm39)	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27,919,374 (GRCm39)	unclassified	probably benign
R6945:Trio	UTSW	15	27,824,176 (GRCm39)	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27,805,740 (GRCm39)	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27,832,137 (GRCm39)	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27,749,885 (GRCm39)	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27,898,086 (GRCm39)	missense	unknown
R7094:Trio	UTSW	15	27,891,534 (GRCm39)	missense	unknown
R7123:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27,871,273 (GRCm39)	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27,828,437 (GRCm39)	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27,871,375 (GRCm39)	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27,732,962 (GRCm39)	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R7451:Trio	UTSW	15	27,747,999 (GRCm39)	missense	probably benign	0.07
R7558:Trio	UTSW	15	27,831,480 (GRCm39)	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27,855,025 (GRCm39)	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27,749,912 (GRCm39)	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27,736,531 (GRCm39)	critical splice donor site	probably null
R7609:Trio	UTSW	15	27,912,728 (GRCm39)	missense	unknown
R7767:Trio	UTSW	15	27,889,504 (GRCm39)	missense	unknown
R7784:Trio	UTSW	15	27,764,080 (GRCm39)	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R7833:Trio	UTSW	15	27,774,172 (GRCm39)	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27,805,770 (GRCm39)	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27,852,010 (GRCm39)	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27,773,021 (GRCm39)	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R8050:Trio	UTSW	15	27,891,540 (GRCm39)	missense	unknown
R8217:Trio	UTSW	15	27,819,055 (GRCm39)	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27,902,996 (GRCm39)	missense	unknown
R8283:Trio	UTSW	15	27,756,628 (GRCm39)	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27,855,108 (GRCm39)	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27,881,412 (GRCm39)	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27,774,038 (GRCm39)	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27,901,286 (GRCm39)	missense	probably benign	0.25
R8682:Trio	UTSW	15	27,905,278 (GRCm39)	missense	unknown
R8688:Trio	UTSW	15	27,748,324 (GRCm39)	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27,732,632 (GRCm39)	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27,919,323 (GRCm39)	missense	unknown
R8713:Trio	UTSW	15	27,744,037 (GRCm39)	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27,851,923 (GRCm39)	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27,905,311 (GRCm39)	missense	unknown
R8816:Trio	UTSW	15	27,741,357 (GRCm39)	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27,741,150 (GRCm39)	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27,732,773 (GRCm39)	missense	probably benign	0.23
R9051:Trio	UTSW	15	27,732,770 (GRCm39)	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27,852,097 (GRCm39)	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27,774,022 (GRCm39)	nonsense	probably null
R9079:Trio	UTSW	15	27,733,023 (GRCm39)	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27,749,922 (GRCm39)	nonsense	probably null
R9494:Trio	UTSW	15	27,846,843 (GRCm39)	missense	probably benign	0.00
R9680:Trio	UTSW	15	27,744,158 (GRCm39)	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27,847,495 (GRCm39)	missense	probably benign	0.00
R9726:Trio	UTSW	15	27,912,752 (GRCm39)	missense	unknown
X0024:Trio	UTSW	15	27,765,812 (GRCm39)	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27,771,473 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTTGGAATGCCATTTCACACG -3'
(R):5'- AGCTTCCCAGAGGACTACTTTC -3'

Sequencing Primer
(F):5'- TGGAATGCCATTTCACACGATGAAC -3'
(R):5'- TTCCCAGAGGACTACTTTCAAGGAG -3'

Posted On

2015-11-11