Incidental Mutation 'R4747:Gm4788'
ID357150
Institutional Source Beutler Lab
Gene Symbol Gm4788
Ensembl Gene ENSMUSG00000070594
Gene Namepredicted gene 4788
Synonyms
MMRRC Submission 042029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4747 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139697623-139781243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139698184 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 792 (C792S)
Ref Sequence ENSEMBL: ENSMUSP00000107617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]
Predicted Effect probably damaging
Transcript: ENSMUST00000027612
AA Change: C780S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594
AA Change: C780S

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 332 386 9.1e-14 SMART
CCP 393 446 1.58e-13 SMART
CCP 455 505 4.92e-1 SMART
CCP 511 564 8.9e-8 SMART
CCP 569 622 4.18e-13 SMART
CCP 627 681 3.5e-15 SMART
CCP 688 742 5.69e-15 SMART
CCP 746 807 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111986
AA Change: C792S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: C792S

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 700 754 5.69e-15 SMART
CCP 758 819 2.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111989
AA Change: C851S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: C851S

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 698 752 3.5e-15 SMART
CCP 759 813 5.69e-15 SMART
CCP 817 878 2.77e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,894 E479D probably damaging Het
4933402D24Rik A G 1: 63,756,409 probably benign Het
Acadvl G T 11: 70,012,508 N340K probably damaging Het
Adgrl4 T A 3: 151,507,440 N372K probably benign Het
Adh1 G A 3: 138,288,881 G321S probably damaging Het
Ankrd26 G T 6: 118,527,757 N730K probably benign Het
Aoc2 A T 11: 101,328,820 probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Ccdc7b T C 8: 129,178,235 V118A probably benign Het
Ccdc88b T A 19: 6,856,141 R219W probably damaging Het
Ccdc97 T C 7: 25,718,923 probably null Het
Cnot1 T C 8: 95,774,682 N86S probably benign Het
Comp T C 8: 70,376,702 C310R probably damaging Het
Crtc2 A T 3: 90,260,211 N281Y probably damaging Het
Cryl1 T C 14: 57,313,102 K102E probably damaging Het
Csf2ra G A 19: 61,226,053 R225* probably null Het
Dao A T 5: 114,012,632 D99V probably benign Het
Dgkd A G 1: 87,934,167 T815A probably damaging Het
Dhrs7 T C 12: 72,653,118 T247A probably benign Het
Dnah7c G C 1: 46,533,168 D934H probably damaging Het
Dnajc15 T C 14: 77,844,456 Y82C probably benign Het
Dnajc4 T C 19: 6,989,504 Q152R probably damaging Het
Dsc1 T C 18: 20,094,558 K541R probably damaging Het
Elp4 G A 2: 105,794,607 R196C probably damaging Het
Epha8 GC G 4: 136,938,695 probably null Het
Ercc6 T C 14: 32,569,907 V1076A probably benign Het
Fgd4 T C 16: 16,423,929 Y677C probably damaging Het
Fndc3b C A 3: 27,428,965 C1028F probably damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gabrr3 T A 16: 59,447,914 probably null Het
Garem1 C A 18: 21,129,943 V605L probably benign Het
Gbp7 A T 3: 142,543,017 D347V probably damaging Het
Gdpd4 A G 7: 97,961,633 T87A possibly damaging Het
Gm12258 C A 11: 58,859,596 H532Q probably damaging Het
Herc2 A G 7: 56,106,393 E727G possibly damaging Het
Hfm1 G A 5: 106,917,523 H97Y probably benign Het
Idua G T 5: 108,681,036 R335L probably damaging Het
Ifi207 A G 1: 173,729,067 S702P probably benign Het
Kif16b A T 2: 142,857,426 V78D probably damaging Het
Klra17 T A 6: 129,872,269 D114V probably damaging Het
Krt76 A G 15: 101,885,745 S481P probably damaging Het
Lhfpl5 A G 17: 28,579,976 D153G probably damaging Het
Med21 T A 6: 146,649,202 D70E possibly damaging Het
Mroh3 A T 1: 136,185,499 M739K probably benign Het
Myo1a A G 10: 127,714,438 E549G probably damaging Het
Narfl A T 17: 25,780,353 Y247F probably benign Het
Neu1 A G 17: 34,934,383 D294G possibly damaging Het
Nmur2 A T 11: 56,040,279 I202K probably benign Het
Nop2 T A 6: 125,137,094 D174E probably benign Het
Ogfr A T 2: 180,594,423 H267L probably damaging Het
Olfr1031 A G 2: 85,991,927 T37A probably damaging Het
Olfr796 G T 10: 129,608,184 A99E possibly damaging Het
P2ry13 T A 3: 59,209,887 I157F probably benign Het
Pank4 T C 4: 154,979,532 V660A probably damaging Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdhb13 T C 18: 37,444,815 Y749H probably damaging Het
Pcdhga3 C A 18: 37,676,746 Q751K probably benign Het
Pcnt C T 10: 76,436,465 E186K possibly damaging Het
Pecam1 A T 11: 106,684,246 F613I probably benign Het
Pias2 T C 18: 77,152,792 *615Q probably null Het
Plb1 A T 5: 32,349,659 M1193L probably benign Het
Pomgnt1 T C 4: 116,156,199 L506P probably damaging Het
Qrfp T C 2: 31,808,840 T27A probably damaging Het
Relb C A 7: 19,627,922 probably null Het
Rgl1 G T 1: 152,524,699 C685* probably null Het
Ric8b A G 10: 84,917,764 Y8C probably benign Het
Rrp36 G A 17: 46,669,967 A161V possibly damaging Het
Samd9l G A 6: 3,375,504 Q586* probably null Het
Sbf1 C T 15: 89,302,713 D821N probably damaging Het
Sept8 G C 11: 53,536,718 A255P probably damaging Het
Skp2 T C 15: 9,113,839 T329A possibly damaging Het
Slc15a2 C T 16: 36,772,136 V220M probably damaging Het
Slc25a11 T A 11: 70,645,956 T63S possibly damaging Het
Sowahc T C 10: 59,223,161 I373T probably benign Het
Sptbn2 T A 19: 4,748,154 M1969K probably benign Het
St14 G A 9: 31,103,757 T315M possibly damaging Het
Tagap G A 17: 7,932,198 R284H probably benign Het
Tdpoz3 T A 3: 93,826,169 S50R possibly damaging Het
Thoc5 A G 11: 4,904,187 D182G probably damaging Het
Tinag A G 9: 76,996,956 V395A probably benign Het
Tmc8 A G 11: 117,792,724 S702G probably benign Het
Tmem202 A G 9: 59,519,194 S230P possibly damaging Het
Tmem203 T C 2: 25,255,752 V28A probably benign Het
Traf3ip1 A T 1: 91,527,757 S647C probably damaging Het
Tram1 A T 1: 13,589,646 I26N probably damaging Het
Ttc6 A T 12: 57,674,692 D989V possibly damaging Het
Ttll6 A G 11: 96,145,546 T334A possibly damaging Het
Ttn A T 2: 76,919,742 D3654E probably damaging Het
Ufd1 T G 16: 18,821,082 V112G probably damaging Het
Usp9y A T Y: 1,391,284 Y629N possibly damaging Het
Vmn2r1 A G 3: 64,081,846 I69V probably benign Het
Zfp180 A T 7: 24,105,821 Y555F probably damaging Het
Zfp438 T C 18: 5,214,403 N185S probably benign Het
Zfp445 C T 9: 122,857,150 V15I possibly damaging Het
Zfp462 A G 4: 55,013,476 E1814G probably benign Het
Other mutations in Gm4788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Gm4788 APN 1 139731574 missense probably damaging 0.99
IGL01088:Gm4788 APN 1 139698085 utr 3 prime probably benign
IGL01419:Gm4788 APN 1 139739644 critical splice acceptor site probably null
IGL01552:Gm4788 APN 1 139739302 missense probably damaging 1.00
IGL01924:Gm4788 APN 1 139739206 missense probably damaging 0.99
IGL02032:Gm4788 APN 1 139774546 missense probably damaging 1.00
IGL02254:Gm4788 APN 1 139733405 splice site probably benign
IGL02318:Gm4788 APN 1 139781097 missense probably benign 0.20
IGL02527:Gm4788 APN 1 139753045 missense probably damaging 1.00
IGL02531:Gm4788 APN 1 139774569 missense probably benign 0.10
IGL02587:Gm4788 APN 1 139701930 missense probably damaging 1.00
IGL02644:Gm4788 APN 1 139781167 start codon destroyed probably null 0.63
IGL02852:Gm4788 APN 1 139774016 missense probably damaging 1.00
IGL02963:Gm4788 APN 1 139731596 nonsense probably null
IGL03084:Gm4788 APN 1 139781142 missense possibly damaging 0.94
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0132:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0549:Gm4788 UTSW 1 139739488 missense probably damaging 1.00
R0558:Gm4788 UTSW 1 139739492 missense probably damaging 0.99
R0610:Gm4788 UTSW 1 139701846 missense probably benign 0.20
R1341:Gm4788 UTSW 1 139732393 missense probably damaging 0.98
R1460:Gm4788 UTSW 1 139698196 missense probably damaging 0.99
R1544:Gm4788 UTSW 1 139736870 missense probably damaging 1.00
R1873:Gm4788 UTSW 1 139774660 missense probably damaging 0.97
R2032:Gm4788 UTSW 1 139733255 splice site probably benign
R2111:Gm4788 UTSW 1 139774679 splice site probably benign
R2179:Gm4788 UTSW 1 139731541 missense probably damaging 1.00
R3806:Gm4788 UTSW 1 139753035 missense probably damaging 1.00
R4356:Gm4788 UTSW 1 139732310 missense probably damaging 1.00
R4838:Gm4788 UTSW 1 139733443 missense probably damaging 1.00
R4867:Gm4788 UTSW 1 139774475 critical splice donor site probably null
R4910:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R4911:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R5050:Gm4788 UTSW 1 139736840 missense probably damaging 0.99
R5120:Gm4788 UTSW 1 139753103 missense probably benign 0.39
R5259:Gm4788 UTSW 1 139740495 missense probably damaging 1.00
R5504:Gm4788 UTSW 1 139701820 missense probably benign 0.18
R5825:Gm4788 UTSW 1 139774598 synonymous probably null
R5949:Gm4788 UTSW 1 139733149 missense probably damaging 0.98
R6140:Gm4788 UTSW 1 139732395 missense probably damaging 1.00
R6200:Gm4788 UTSW 1 139754335 missense probably damaging 0.97
R6254:Gm4788 UTSW 1 139754390 missense probably damaging 0.98
R6255:Gm4788 UTSW 1 139753011 nonsense probably null
R6334:Gm4788 UTSW 1 139773924 unclassified probably null
R6611:Gm4788 UTSW 1 139732390 missense probably damaging 1.00
R6798:Gm4788 UTSW 1 139698121 missense probably benign 0.20
R6800:Gm4788 UTSW 1 139701981 missense possibly damaging 0.85
R6895:Gm4788 UTSW 1 139740472 missense possibly damaging 0.84
R6904:Gm4788 UTSW 1 139731653 missense possibly damaging 0.79
R6994:Gm4788 UTSW 1 139736930 missense possibly damaging 0.67
R7173:Gm4788 UTSW 1 139731677 nonsense probably null
R7184:Gm4788 UTSW 1 139733084 missense possibly damaging 0.65
R7192:Gm4788 UTSW 1 139739295 missense probably damaging 0.96
R7205:Gm4788 UTSW 1 139753050 nonsense probably null
R7308:Gm4788 UTSW 1 139754303 missense possibly damaging 0.71
X0009:Gm4788 UTSW 1 139733549 missense probably benign 0.08
X0024:Gm4788 UTSW 1 139733509 missense probably damaging 1.00
Z1088:Gm4788 UTSW 1 139754261 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTTGTCCTTGGACATATAATGG -3'
(R):5'- ACGTCTATTGAGATAAGTTAACTGCAG -3'

Sequencing Primer
(F):5'- AGGAGTTTTGAATGTACTGCATTTGC -3'
(R):5'- CCTTCAGATGCATGTATAATACC -3'
Posted On2015-11-11