Incidental Mutation 'R4747:Fndc3b'
ID357162
Institutional Source Beutler Lab
Gene Symbol Fndc3b
Ensembl Gene ENSMUSG00000039286
Gene Namefibronectin type III domain containing 3B
Synonymsfad104, 1600019O04Rik
MMRRC Submission 042029-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4747 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27416162-27711307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27428965 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1028 (C1028F)
Ref Sequence ENSEMBL: ENSMUSP00000141620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000195008]
Predicted Effect probably damaging
Transcript: ENSMUST00000046157
AA Change: C1028F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: C1028F

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195008
AA Change: C1028F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: C1028F

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,894 E479D probably damaging Het
4933402D24Rik A G 1: 63,756,409 probably benign Het
Acadvl G T 11: 70,012,508 N340K probably damaging Het
Adgrl4 T A 3: 151,507,440 N372K probably benign Het
Adh1 G A 3: 138,288,881 G321S probably damaging Het
Ankrd26 G T 6: 118,527,757 N730K probably benign Het
Aoc2 A T 11: 101,328,820 probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Ccdc7b T C 8: 129,178,235 V118A probably benign Het
Ccdc88b T A 19: 6,856,141 R219W probably damaging Het
Ccdc97 T C 7: 25,718,923 probably null Het
Cnot1 T C 8: 95,774,682 N86S probably benign Het
Comp T C 8: 70,376,702 C310R probably damaging Het
Crtc2 A T 3: 90,260,211 N281Y probably damaging Het
Cryl1 T C 14: 57,313,102 K102E probably damaging Het
Csf2ra G A 19: 61,226,053 R225* probably null Het
Dao A T 5: 114,012,632 D99V probably benign Het
Dgkd A G 1: 87,934,167 T815A probably damaging Het
Dhrs7 T C 12: 72,653,118 T247A probably benign Het
Dnah7c G C 1: 46,533,168 D934H probably damaging Het
Dnajc15 T C 14: 77,844,456 Y82C probably benign Het
Dnajc4 T C 19: 6,989,504 Q152R probably damaging Het
Dsc1 T C 18: 20,094,558 K541R probably damaging Het
Elp4 G A 2: 105,794,607 R196C probably damaging Het
Epha8 GC G 4: 136,938,695 probably null Het
Ercc6 T C 14: 32,569,907 V1076A probably benign Het
Fgd4 T C 16: 16,423,929 Y677C probably damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gabrr3 T A 16: 59,447,914 probably null Het
Garem1 C A 18: 21,129,943 V605L probably benign Het
Gbp7 A T 3: 142,543,017 D347V probably damaging Het
Gdpd4 A G 7: 97,961,633 T87A possibly damaging Het
Gm12258 C A 11: 58,859,596 H532Q probably damaging Het
Gm4788 A T 1: 139,698,184 C792S probably damaging Het
Herc2 A G 7: 56,106,393 E727G possibly damaging Het
Hfm1 G A 5: 106,917,523 H97Y probably benign Het
Idua G T 5: 108,681,036 R335L probably damaging Het
Ifi207 A G 1: 173,729,067 S702P probably benign Het
Kif16b A T 2: 142,857,426 V78D probably damaging Het
Klra17 T A 6: 129,872,269 D114V probably damaging Het
Krt76 A G 15: 101,885,745 S481P probably damaging Het
Lhfpl5 A G 17: 28,579,976 D153G probably damaging Het
Med21 T A 6: 146,649,202 D70E possibly damaging Het
Mroh3 A T 1: 136,185,499 M739K probably benign Het
Myo1a A G 10: 127,714,438 E549G probably damaging Het
Narfl A T 17: 25,780,353 Y247F probably benign Het
Neu1 A G 17: 34,934,383 D294G possibly damaging Het
Nmur2 A T 11: 56,040,279 I202K probably benign Het
Nop2 T A 6: 125,137,094 D174E probably benign Het
Ogfr A T 2: 180,594,423 H267L probably damaging Het
Olfr1031 A G 2: 85,991,927 T37A probably damaging Het
Olfr796 G T 10: 129,608,184 A99E possibly damaging Het
P2ry13 T A 3: 59,209,887 I157F probably benign Het
Pank4 T C 4: 154,979,532 V660A probably damaging Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdhb13 T C 18: 37,444,815 Y749H probably damaging Het
Pcdhga3 C A 18: 37,676,746 Q751K probably benign Het
Pcnt C T 10: 76,436,465 E186K possibly damaging Het
Pecam1 A T 11: 106,684,246 F613I probably benign Het
Pias2 T C 18: 77,152,792 *615Q probably null Het
Plb1 A T 5: 32,349,659 M1193L probably benign Het
Pomgnt1 T C 4: 116,156,199 L506P probably damaging Het
Qrfp T C 2: 31,808,840 T27A probably damaging Het
Relb C A 7: 19,627,922 probably null Het
Rgl1 G T 1: 152,524,699 C685* probably null Het
Ric8b A G 10: 84,917,764 Y8C probably benign Het
Rrp36 G A 17: 46,669,967 A161V possibly damaging Het
Samd9l G A 6: 3,375,504 Q586* probably null Het
Sbf1 C T 15: 89,302,713 D821N probably damaging Het
Sept8 G C 11: 53,536,718 A255P probably damaging Het
Skp2 T C 15: 9,113,839 T329A possibly damaging Het
Slc15a2 C T 16: 36,772,136 V220M probably damaging Het
Slc25a11 T A 11: 70,645,956 T63S possibly damaging Het
Sowahc T C 10: 59,223,161 I373T probably benign Het
Sptbn2 T A 19: 4,748,154 M1969K probably benign Het
St14 G A 9: 31,103,757 T315M possibly damaging Het
Tagap G A 17: 7,932,198 R284H probably benign Het
Tdpoz3 T A 3: 93,826,169 S50R possibly damaging Het
Thoc5 A G 11: 4,904,187 D182G probably damaging Het
Tinag A G 9: 76,996,956 V395A probably benign Het
Tmc8 A G 11: 117,792,724 S702G probably benign Het
Tmem202 A G 9: 59,519,194 S230P possibly damaging Het
Tmem203 T C 2: 25,255,752 V28A probably benign Het
Traf3ip1 A T 1: 91,527,757 S647C probably damaging Het
Tram1 A T 1: 13,589,646 I26N probably damaging Het
Ttc6 A T 12: 57,674,692 D989V possibly damaging Het
Ttll6 A G 11: 96,145,546 T334A possibly damaging Het
Ttn A T 2: 76,919,742 D3654E probably damaging Het
Ufd1 T G 16: 18,821,082 V112G probably damaging Het
Usp9y A T Y: 1,391,284 Y629N possibly damaging Het
Vmn2r1 A G 3: 64,081,846 I69V probably benign Het
Zfp180 A T 7: 24,105,821 Y555F probably damaging Het
Zfp438 T C 18: 5,214,403 N185S probably benign Het
Zfp445 C T 9: 122,857,150 V15I possibly damaging Het
Zfp462 A G 4: 55,013,476 E1814G probably benign Het
Other mutations in Fndc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fndc3b APN 3 27538012 missense probably benign 0.40
IGL00848:Fndc3b APN 3 27451509 missense probably damaging 1.00
IGL01099:Fndc3b APN 3 27463817 missense probably benign 0.10
IGL01459:Fndc3b APN 3 27461740 missense probably benign 0.11
IGL01583:Fndc3b APN 3 27428995 missense probably damaging 1.00
IGL01736:Fndc3b APN 3 27467403 missense probably damaging 1.00
IGL02154:Fndc3b APN 3 27538117 missense probably damaging 0.99
IGL02377:Fndc3b APN 3 27620652 missense probably damaging 1.00
IGL02470:Fndc3b APN 3 27461720 missense probably damaging 1.00
IGL02508:Fndc3b APN 3 27458751 missense probably damaging 1.00
IGL02834:Fndc3b APN 3 27508503 missense probably damaging 1.00
IGL02974:Fndc3b APN 3 27488276 missense probably damaging 1.00
IGL02999:Fndc3b APN 3 27538239 missense probably damaging 1.00
IGL03083:Fndc3b APN 3 27467427 missense probably benign 0.10
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0101:Fndc3b UTSW 3 27458808 missense probably damaging 1.00
R0279:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0281:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0325:Fndc3b UTSW 3 27467430 missense probably damaging 1.00
R0398:Fndc3b UTSW 3 27461779 missense probably benign 0.19
R1334:Fndc3b UTSW 3 27458851 missense probably damaging 1.00
R1464:Fndc3b UTSW 3 27440185 splice site probably benign
R1961:Fndc3b UTSW 3 27456451 nonsense probably null
R1993:Fndc3b UTSW 3 27419400 missense probably benign
R2087:Fndc3b UTSW 3 27451554 missense probably benign 0.00
R2113:Fndc3b UTSW 3 27643036 missense probably damaging 1.00
R2258:Fndc3b UTSW 3 27440160 missense possibly damaging 0.93
R2437:Fndc3b UTSW 3 27451332 missense probably damaging 0.99
R2930:Fndc3b UTSW 3 27470286 missense probably benign
R2997:Fndc3b UTSW 3 27468872 missense probably benign 0.00
R3151:Fndc3b UTSW 3 27419503 missense possibly damaging 0.93
R3782:Fndc3b UTSW 3 27459986 missense possibly damaging 0.81
R4255:Fndc3b UTSW 3 27501407 missense possibly damaging 0.77
R4628:Fndc3b UTSW 3 27556128 missense probably benign 0.19
R4849:Fndc3b UTSW 3 27459948 missense probably damaging 1.00
R5185:Fndc3b UTSW 3 27457070 missense probably benign 0.14
R5291:Fndc3b UTSW 3 27642995 missense probably benign 0.39
R5392:Fndc3b UTSW 3 27465787 nonsense probably null
R5540:Fndc3b UTSW 3 27501502 missense probably damaging 1.00
R5554:Fndc3b UTSW 3 27643013 missense possibly damaging 0.69
R5635:Fndc3b UTSW 3 27541931 missense probably damaging 1.00
R5639:Fndc3b UTSW 3 27426153 missense probably damaging 0.98
R5678:Fndc3b UTSW 3 27429023 missense probably benign
R5732:Fndc3b UTSW 3 27461773 missense probably damaging 1.00
R5880:Fndc3b UTSW 3 27428903 missense probably damaging 1.00
R6539:Fndc3b UTSW 3 27538057 missense probably benign 0.22
R7038:Fndc3b UTSW 3 27501469 missense probably benign 0.23
R7102:Fndc3b UTSW 3 27470234 missense possibly damaging 0.73
R7203:Fndc3b UTSW 3 27456485 missense probably benign 0.00
R7472:Fndc3b UTSW 3 27461744 missense probably benign 0.00
X0028:Fndc3b UTSW 3 27451434 missense possibly damaging 0.72
Z1088:Fndc3b UTSW 3 27465808 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATATGAAGACTGCATTTGTGGTCAG -3'
(R):5'- CAACTGGGTGCTTCAGACTG -3'

Sequencing Primer
(F):5'- TGGTCAGAATTGAGTTCCCTAC -3'
(R):5'- TGCTTCAGACTGCAGGAAGC -3'
Posted On2015-11-11