Incidental Mutation 'R4747:Pcnt'
ID357203
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission 042029-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4747 (G1)
Quality Score189
Status Not validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76436465 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 186 (E186K)
Ref Sequence ENSEMBL: ENSMUSP00000001179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001179
AA Change: E186K

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: E186K

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000217838
AA Change: E186K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,894 E479D probably damaging Het
4933402D24Rik A G 1: 63,756,409 probably benign Het
Acadvl G T 11: 70,012,508 N340K probably damaging Het
Adgrl4 T A 3: 151,507,440 N372K probably benign Het
Adh1 G A 3: 138,288,881 G321S probably damaging Het
Ankrd26 G T 6: 118,527,757 N730K probably benign Het
Aoc2 A T 11: 101,328,820 probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Ccdc7b T C 8: 129,178,235 V118A probably benign Het
Ccdc88b T A 19: 6,856,141 R219W probably damaging Het
Ccdc97 T C 7: 25,718,923 probably null Het
Cnot1 T C 8: 95,774,682 N86S probably benign Het
Comp T C 8: 70,376,702 C310R probably damaging Het
Crtc2 A T 3: 90,260,211 N281Y probably damaging Het
Cryl1 T C 14: 57,313,102 K102E probably damaging Het
Csf2ra G A 19: 61,226,053 R225* probably null Het
Dao A T 5: 114,012,632 D99V probably benign Het
Dgkd A G 1: 87,934,167 T815A probably damaging Het
Dhrs7 T C 12: 72,653,118 T247A probably benign Het
Dnah7c G C 1: 46,533,168 D934H probably damaging Het
Dnajc15 T C 14: 77,844,456 Y82C probably benign Het
Dnajc4 T C 19: 6,989,504 Q152R probably damaging Het
Dsc1 T C 18: 20,094,558 K541R probably damaging Het
Elp4 G A 2: 105,794,607 R196C probably damaging Het
Epha8 GC G 4: 136,938,695 probably null Het
Ercc6 T C 14: 32,569,907 V1076A probably benign Het
Fgd4 T C 16: 16,423,929 Y677C probably damaging Het
Fndc3b C A 3: 27,428,965 C1028F probably damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gabrr3 T A 16: 59,447,914 probably null Het
Garem1 C A 18: 21,129,943 V605L probably benign Het
Gbp7 A T 3: 142,543,017 D347V probably damaging Het
Gdpd4 A G 7: 97,961,633 T87A possibly damaging Het
Gm12258 C A 11: 58,859,596 H532Q probably damaging Het
Gm4788 A T 1: 139,698,184 C792S probably damaging Het
Herc2 A G 7: 56,106,393 E727G possibly damaging Het
Hfm1 G A 5: 106,917,523 H97Y probably benign Het
Idua G T 5: 108,681,036 R335L probably damaging Het
Ifi207 A G 1: 173,729,067 S702P probably benign Het
Kif16b A T 2: 142,857,426 V78D probably damaging Het
Klra17 T A 6: 129,872,269 D114V probably damaging Het
Krt76 A G 15: 101,885,745 S481P probably damaging Het
Lhfpl5 A G 17: 28,579,976 D153G probably damaging Het
Med21 T A 6: 146,649,202 D70E possibly damaging Het
Mroh3 A T 1: 136,185,499 M739K probably benign Het
Myo1a A G 10: 127,714,438 E549G probably damaging Het
Narfl A T 17: 25,780,353 Y247F probably benign Het
Neu1 A G 17: 34,934,383 D294G possibly damaging Het
Nmur2 A T 11: 56,040,279 I202K probably benign Het
Nop2 T A 6: 125,137,094 D174E probably benign Het
Ogfr A T 2: 180,594,423 H267L probably damaging Het
Olfr1031 A G 2: 85,991,927 T37A probably damaging Het
Olfr796 G T 10: 129,608,184 A99E possibly damaging Het
P2ry13 T A 3: 59,209,887 I157F probably benign Het
Pank4 T C 4: 154,979,532 V660A probably damaging Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdhb13 T C 18: 37,444,815 Y749H probably damaging Het
Pcdhga3 C A 18: 37,676,746 Q751K probably benign Het
Pecam1 A T 11: 106,684,246 F613I probably benign Het
Pias2 T C 18: 77,152,792 *615Q probably null Het
Plb1 A T 5: 32,349,659 M1193L probably benign Het
Pomgnt1 T C 4: 116,156,199 L506P probably damaging Het
Qrfp T C 2: 31,808,840 T27A probably damaging Het
Relb C A 7: 19,627,922 probably null Het
Rgl1 G T 1: 152,524,699 C685* probably null Het
Ric8b A G 10: 84,917,764 Y8C probably benign Het
Rrp36 G A 17: 46,669,967 A161V possibly damaging Het
Samd9l G A 6: 3,375,504 Q586* probably null Het
Sbf1 C T 15: 89,302,713 D821N probably damaging Het
Sept8 G C 11: 53,536,718 A255P probably damaging Het
Skp2 T C 15: 9,113,839 T329A possibly damaging Het
Slc15a2 C T 16: 36,772,136 V220M probably damaging Het
Slc25a11 T A 11: 70,645,956 T63S possibly damaging Het
Sowahc T C 10: 59,223,161 I373T probably benign Het
Sptbn2 T A 19: 4,748,154 M1969K probably benign Het
St14 G A 9: 31,103,757 T315M possibly damaging Het
Tagap G A 17: 7,932,198 R284H probably benign Het
Tdpoz3 T A 3: 93,826,169 S50R possibly damaging Het
Thoc5 A G 11: 4,904,187 D182G probably damaging Het
Tinag A G 9: 76,996,956 V395A probably benign Het
Tmc8 A G 11: 117,792,724 S702G probably benign Het
Tmem202 A G 9: 59,519,194 S230P possibly damaging Het
Tmem203 T C 2: 25,255,752 V28A probably benign Het
Traf3ip1 A T 1: 91,527,757 S647C probably damaging Het
Tram1 A T 1: 13,589,646 I26N probably damaging Het
Ttc6 A T 12: 57,674,692 D989V possibly damaging Het
Ttll6 A G 11: 96,145,546 T334A possibly damaging Het
Ttn A T 2: 76,919,742 D3654E probably damaging Het
Ufd1 T G 16: 18,821,082 V112G probably damaging Het
Usp9y A T Y: 1,391,284 Y629N possibly damaging Het
Vmn2r1 A G 3: 64,081,846 I69V probably benign Het
Zfp180 A T 7: 24,105,821 Y555F probably damaging Het
Zfp438 T C 18: 5,214,403 N185S probably benign Het
Zfp445 C T 9: 122,857,150 V15I possibly damaging Het
Zfp462 A G 4: 55,013,476 E1814G probably benign Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 intron probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGAAAATCAGCAGGCTGC -3'
(R):5'- TGAGCCTGAACAACATGCAC -3'

Sequencing Primer
(F):5'- CAGGCTGCTTCAAGTTGTGC -3'
(R):5'- TGAACAACATGCACACAGC -3'
Posted On2015-11-11