Incidental Mutation 'R4747:Aoc2'
ID357214
Institutional Source Beutler Lab
Gene Symbol Aoc2
Ensembl Gene ENSMUSG00000078651
Gene Nameamine oxidase, copper containing 2 (retina-specific)
Synonyms
MMRRC Submission 042029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4747 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101325063-101329702 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 101328820 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000041095] [ENSMUST00000103105] [ENSMUST00000107264]
Predicted Effect probably benign
Transcript: ENSMUST00000017316
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041095
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103105
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107264
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and quinone cofactor. This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The protein contains several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine, and putrescine. This gene may be a candidate gene for hereditary ocular diseases. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,894 E479D probably damaging Het
4933402D24Rik A G 1: 63,756,409 probably benign Het
Acadvl G T 11: 70,012,508 N340K probably damaging Het
Adgrl4 T A 3: 151,507,440 N372K probably benign Het
Adh1 G A 3: 138,288,881 G321S probably damaging Het
Ankrd26 G T 6: 118,527,757 N730K probably benign Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Ccdc7b T C 8: 129,178,235 V118A probably benign Het
Ccdc88b T A 19: 6,856,141 R219W probably damaging Het
Ccdc97 T C 7: 25,718,923 probably null Het
Cnot1 T C 8: 95,774,682 N86S probably benign Het
Comp T C 8: 70,376,702 C310R probably damaging Het
Crtc2 A T 3: 90,260,211 N281Y probably damaging Het
Cryl1 T C 14: 57,313,102 K102E probably damaging Het
Csf2ra G A 19: 61,226,053 R225* probably null Het
Dao A T 5: 114,012,632 D99V probably benign Het
Dgkd A G 1: 87,934,167 T815A probably damaging Het
Dhrs7 T C 12: 72,653,118 T247A probably benign Het
Dnah7c G C 1: 46,533,168 D934H probably damaging Het
Dnajc15 T C 14: 77,844,456 Y82C probably benign Het
Dnajc4 T C 19: 6,989,504 Q152R probably damaging Het
Dsc1 T C 18: 20,094,558 K541R probably damaging Het
Elp4 G A 2: 105,794,607 R196C probably damaging Het
Epha8 GC G 4: 136,938,695 probably null Het
Ercc6 T C 14: 32,569,907 V1076A probably benign Het
Fgd4 T C 16: 16,423,929 Y677C probably damaging Het
Fndc3b C A 3: 27,428,965 C1028F probably damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gabrr3 T A 16: 59,447,914 probably null Het
Garem1 C A 18: 21,129,943 V605L probably benign Het
Gbp7 A T 3: 142,543,017 D347V probably damaging Het
Gdpd4 A G 7: 97,961,633 T87A possibly damaging Het
Gm12258 C A 11: 58,859,596 H532Q probably damaging Het
Gm4788 A T 1: 139,698,184 C792S probably damaging Het
Herc2 A G 7: 56,106,393 E727G possibly damaging Het
Hfm1 G A 5: 106,917,523 H97Y probably benign Het
Idua G T 5: 108,681,036 R335L probably damaging Het
Ifi207 A G 1: 173,729,067 S702P probably benign Het
Kif16b A T 2: 142,857,426 V78D probably damaging Het
Klra17 T A 6: 129,872,269 D114V probably damaging Het
Krt76 A G 15: 101,885,745 S481P probably damaging Het
Lhfpl5 A G 17: 28,579,976 D153G probably damaging Het
Med21 T A 6: 146,649,202 D70E possibly damaging Het
Mroh3 A T 1: 136,185,499 M739K probably benign Het
Myo1a A G 10: 127,714,438 E549G probably damaging Het
Narfl A T 17: 25,780,353 Y247F probably benign Het
Neu1 A G 17: 34,934,383 D294G possibly damaging Het
Nmur2 A T 11: 56,040,279 I202K probably benign Het
Nop2 T A 6: 125,137,094 D174E probably benign Het
Ogfr A T 2: 180,594,423 H267L probably damaging Het
Olfr1031 A G 2: 85,991,927 T37A probably damaging Het
Olfr796 G T 10: 129,608,184 A99E possibly damaging Het
P2ry13 T A 3: 59,209,887 I157F probably benign Het
Pank4 T C 4: 154,979,532 V660A probably damaging Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdhb13 T C 18: 37,444,815 Y749H probably damaging Het
Pcdhga3 C A 18: 37,676,746 Q751K probably benign Het
Pcnt C T 10: 76,436,465 E186K possibly damaging Het
Pecam1 A T 11: 106,684,246 F613I probably benign Het
Pias2 T C 18: 77,152,792 *615Q probably null Het
Plb1 A T 5: 32,349,659 M1193L probably benign Het
Pomgnt1 T C 4: 116,156,199 L506P probably damaging Het
Qrfp T C 2: 31,808,840 T27A probably damaging Het
Relb C A 7: 19,627,922 probably null Het
Rgl1 G T 1: 152,524,699 C685* probably null Het
Ric8b A G 10: 84,917,764 Y8C probably benign Het
Rrp36 G A 17: 46,669,967 A161V possibly damaging Het
Samd9l G A 6: 3,375,504 Q586* probably null Het
Sbf1 C T 15: 89,302,713 D821N probably damaging Het
Sept8 G C 11: 53,536,718 A255P probably damaging Het
Skp2 T C 15: 9,113,839 T329A possibly damaging Het
Slc15a2 C T 16: 36,772,136 V220M probably damaging Het
Slc25a11 T A 11: 70,645,956 T63S possibly damaging Het
Sowahc T C 10: 59,223,161 I373T probably benign Het
Sptbn2 T A 19: 4,748,154 M1969K probably benign Het
St14 G A 9: 31,103,757 T315M possibly damaging Het
Tagap G A 17: 7,932,198 R284H probably benign Het
Tdpoz3 T A 3: 93,826,169 S50R possibly damaging Het
Thoc5 A G 11: 4,904,187 D182G probably damaging Het
Tinag A G 9: 76,996,956 V395A probably benign Het
Tmc8 A G 11: 117,792,724 S702G probably benign Het
Tmem202 A G 9: 59,519,194 S230P possibly damaging Het
Tmem203 T C 2: 25,255,752 V28A probably benign Het
Traf3ip1 A T 1: 91,527,757 S647C probably damaging Het
Tram1 A T 1: 13,589,646 I26N probably damaging Het
Ttc6 A T 12: 57,674,692 D989V possibly damaging Het
Ttll6 A G 11: 96,145,546 T334A possibly damaging Het
Ttn A T 2: 76,919,742 D3654E probably damaging Het
Ufd1 T G 16: 18,821,082 V112G probably damaging Het
Usp9y A T Y: 1,391,284 Y629N possibly damaging Het
Vmn2r1 A G 3: 64,081,846 I69V probably benign Het
Zfp180 A T 7: 24,105,821 Y555F probably damaging Het
Zfp438 T C 18: 5,214,403 N185S probably benign Het
Zfp445 C T 9: 122,857,150 V15I possibly damaging Het
Zfp462 A G 4: 55,013,476 E1814G probably benign Het
Other mutations in Aoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01900:Aoc2 APN 11 101328823 missense probably damaging 1.00
IGL02340:Aoc2 APN 11 101326375 missense probably damaging 1.00
IGL02382:Aoc2 APN 11 101326672 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0398:Aoc2 UTSW 11 101325553 missense possibly damaging 0.56
R1430:Aoc2 UTSW 11 101326495 missense probably damaging 1.00
R1681:Aoc2 UTSW 11 101325192 missense probably benign
R3157:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R3158:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R4159:Aoc2 UTSW 11 101325296 missense probably damaging 0.98
R5120:Aoc2 UTSW 11 101325714 missense probably benign 0.00
R5902:Aoc2 UTSW 11 101329246 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6317:Aoc2 UTSW 11 101325466 missense probably damaging 1.00
R6778:Aoc2 UTSW 11 101325361 missense probably damaging 0.99
R7323:Aoc2 UTSW 11 101328545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACCGAATCCAGATCCACAG -3'
(R):5'- TCAGGAAGAGATGGCTTTCCCC -3'

Sequencing Primer
(F):5'- ATGTGCCTCTGGAGAGCAG -3'
(R):5'- GGAAGAGATGGCTTTCCCCATTATC -3'
Posted On2015-11-11