Incidental Mutation 'R4748:Enam'
ID357278
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Nameenamelin
Synonymsabte
MMRRC Submission 042030-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R4748 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88487975-88506049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88501543 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 304 (P304T)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
Predicted Effect probably damaging
Transcript: ENSMUST00000031222
AA Change: P229T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: P229T

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199104
AA Change: P304T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: P304T

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,856,656 E54D possibly damaging Het
4933415F23Rik T C 1: 23,101,870 E121G probably damaging Het
Abcb6 C A 1: 75,177,358 G367W probably damaging Het
Asprv1 A G 6: 86,628,423 M84V probably damaging Het
Aspscr1 T C 11: 120,701,507 V291A probably damaging Het
B4galnt4 T C 7: 141,071,720 F980L probably damaging Het
Bpi G A 2: 158,272,021 V280I possibly damaging Het
Bptf T C 11: 107,095,880 D581G probably damaging Het
Cap2 T A 13: 46,639,826 Y223N possibly damaging Het
Ccdc141 A C 2: 77,057,980 I480M possibly damaging Het
Ccnh T A 13: 85,189,639 V35E probably benign Het
Cd6 G T 19: 10,794,225 S433* probably null Het
Ceacam10 A C 7: 24,781,052 I83L probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Chia1 A T 3: 106,122,449 D73V probably damaging Het
Commd2 G A 3: 57,646,794 T162I probably benign Het
Creb3l3 C T 10: 81,086,047 A316T probably benign Het
Cul4a A G 8: 13,123,526 K1R probably benign Het
Cyp2c23 T C 19: 44,016,737 probably null Het
D630045J12Rik T C 6: 38,196,841 T131A possibly damaging Het
Dctn4 A C 18: 60,550,236 K295N probably damaging Het
Dnah1 A G 14: 31,319,945 V23A probably benign Het
Dync1i1 A G 6: 5,767,048 K91E possibly damaging Het
Dzip1l A G 9: 99,642,651 D275G probably damaging Het
Enpep A G 3: 129,332,163 Y107H probably damaging Het
Exd2 T C 12: 80,480,576 L27P probably damaging Het
Fam135b T A 15: 71,464,055 D430V probably benign Het
Fam222b C T 11: 78,154,603 T202I possibly damaging Het
Fmod T A 1: 134,041,174 N317K probably damaging Het
Frem2 A G 3: 53,541,093 F2301L probably damaging Het
Frem3 T C 8: 80,611,459 F127S probably damaging Het
Gbp7 A G 3: 142,538,087 S132G probably benign Het
Gm4787 A G 12: 81,378,056 C443R probably damaging Het
Grik2 T C 10: 49,535,341 M5V possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,555,333 L429F probably damaging Het
Lrr1 C A 12: 69,174,462 T126K probably benign Het
Mgat4e C A 1: 134,542,028 D93Y probably damaging Het
Mllt3 A T 4: 87,840,781 S343R possibly damaging Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Mtrf1 C T 14: 79,411,650 H237Y probably damaging Het
Nckap1l T A 15: 103,473,056 L408Q probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr273 A G 4: 52,856,076 S146P possibly damaging Het
Olfr738 T G 14: 50,413,876 L111V possibly damaging Het
Otud7a T C 7: 63,735,915 S376P possibly damaging Het
Pabpc2 A T 18: 39,774,269 K196* probably null Het
Paqr8 T A 1: 20,935,413 C264S probably benign Het
Pgm2 T A 4: 99,981,979 F459Y probably benign Het
Phip C A 9: 82,908,869 V675L probably benign Het
Pnma1 T G 12: 84,147,723 T69P probably benign Het
Ptpn12 A T 5: 21,005,385 C242* probably null Het
Rabep1 T A 11: 70,908,468 V306E probably benign Het
Ros1 C T 10: 52,115,997 D1377N probably benign Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Scaf11 G A 15: 96,420,421 Q421* probably null Het
Shcbp1 G A 8: 4,744,512 T427M probably damaging Het
Shprh G A 10: 11,170,476 R979H probably damaging Het
Slc22a27 C T 19: 7,925,876 C163Y probably benign Het
Slc27a1 A G 8: 71,580,675 D287G probably damaging Het
Slc27a1 C T 8: 71,580,809 T310M possibly damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc35f2 A T 9: 53,771,785 M1L probably benign Het
Sltm G C 9: 70,581,365 R599T probably damaging Het
Spic T A 10: 88,675,890 Q168L probably damaging Het
Spink6 G A 18: 44,082,361 probably null Het
Stac2 T C 11: 98,041,372 E235G possibly damaging Het
Szt2 G A 4: 118,389,191 Q957* probably null Het
Them7 A T 2: 105,378,646 T104S possibly damaging Het
Tmed4 T A 11: 6,271,716 I207F possibly damaging Het
Tmem248 A G 5: 130,236,890 E178G probably benign Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Trim80 C A 11: 115,448,138 T598N possibly damaging Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Vil1 C T 1: 74,421,266 A194V probably damaging Het
Vmn2r61 A T 7: 42,267,141 M393L probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Vps33b G T 7: 80,290,048 A516S probably damaging Het
Wisp1 C A 15: 66,906,640 Y103* probably null Het
Zc3h6 G A 2: 129,002,240 G235R probably damaging Het
Zfp612 T A 8: 110,088,672 D170E probably benign Het
Zfp746 A G 6: 48,064,556 I412T probably benign Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88501484 missense possibly damaging 0.83
IGL01611:Enam APN 5 88503749 missense probably damaging 0.99
IGL01802:Enam APN 5 88503674 missense possibly damaging 0.93
IGL02220:Enam APN 5 88504559 nonsense probably null
IGL02371:Enam APN 5 88502809 missense probably benign 0.39
IGL02596:Enam APN 5 88503026 missense probably benign 0.01
IGL03026:Enam APN 5 88503299 missense probably benign 0.38
IGL03303:Enam APN 5 88504591 missense probably benign 0.12
opinionated UTSW 5 88503026 missense probably benign 0.04
recalcitrant UTSW 5 88503791 nonsense probably null
R0200:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0230:Enam UTSW 5 88489655 splice site probably benign
R0395:Enam UTSW 5 88501508 missense probably damaging 0.99
R0548:Enam UTSW 5 88503105 missense probably damaging 0.96
R0608:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0724:Enam UTSW 5 88501994 missense probably damaging 1.00
R0927:Enam UTSW 5 88494060 missense possibly damaging 0.72
R1023:Enam UTSW 5 88501967 missense probably damaging 0.99
R1053:Enam UTSW 5 88504019 missense possibly damaging 0.64
R1169:Enam UTSW 5 88503258 missense probably damaging 1.00
R1230:Enam UTSW 5 88494068 missense probably damaging 0.99
R1324:Enam UTSW 5 88494068 missense possibly damaging 0.53
R1663:Enam UTSW 5 88503994 missense probably damaging 1.00
R1727:Enam UTSW 5 88503994 missense probably damaging 1.00
R1750:Enam UTSW 5 88503227 missense probably damaging 1.00
R1852:Enam UTSW 5 88504465 missense possibly damaging 0.92
R1907:Enam UTSW 5 88504622 missense possibly damaging 0.86
R2104:Enam UTSW 5 88501787 missense probably damaging 1.00
R2143:Enam UTSW 5 88492920 missense probably benign 0.02
R2196:Enam UTSW 5 88502744 missense probably damaging 0.99
R2363:Enam UTSW 5 88503149 missense probably benign 0.24
R2497:Enam UTSW 5 88502694 missense probably benign 0.13
R3615:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3616:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3782:Enam UTSW 5 88502815 missense probably damaging 1.00
R4067:Enam UTSW 5 88503377 missense probably damaging 1.00
R4349:Enam UTSW 5 88503548 missense probably damaging 0.99
R4604:Enam UTSW 5 88504283 missense possibly damaging 0.93
R4649:Enam UTSW 5 88492968 missense probably benign 0.02
R4702:Enam UTSW 5 88503791 nonsense probably null
R4703:Enam UTSW 5 88503791 nonsense probably null
R4704:Enam UTSW 5 88503791 nonsense probably null
R4705:Enam UTSW 5 88503791 nonsense probably null
R4714:Enam UTSW 5 88503536 missense probably damaging 1.00
R4838:Enam UTSW 5 88493108 nonsense probably null
R4840:Enam UTSW 5 88503026 missense probably benign 0.04
R4856:Enam UTSW 5 88488734 nonsense probably null
R4886:Enam UTSW 5 88488734 nonsense probably null
R4910:Enam UTSW 5 88502314 missense probably benign
R4911:Enam UTSW 5 88502314 missense probably benign
R6103:Enam UTSW 5 88502328 missense probably damaging 0.96
R6651:Enam UTSW 5 88502917 missense probably damaging 0.98
R6759:Enam UTSW 5 88501691 missense probably damaging 1.00
R7282:Enam UTSW 5 88502327 missense probably damaging 0.99
X0018:Enam UTSW 5 88502691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCATGGTATGAGAAGCCTG -3'
(R):5'- AGGGAAGACACCGTTTTGAAC -3'

Sequencing Primer
(F):5'- AAGCCTGTGGAGGAACTTTC -3'
(R):5'- AACTGTAGGATTGTTCCCAGC -3'
Posted On2015-11-11