Incidental Mutation 'R4748:Grik2'
ID357308
Institutional Source Beutler Lab
Gene Symbol Grik2
Ensembl Gene ENSMUSG00000056073
Gene Nameglutamate receptor, ionotropic, kainate 2 (beta 2)
SynonymsGlurbeta2, Glur-6, Glur6
MMRRC Submission 042030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4748 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location49094833-49788766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49535341 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 5 (M5V)
Ref Sequence ENSEMBL: ENSMUSP00000152029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218669] [ENSMUST00000218823] [ENSMUST00000220263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079751
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: M234V

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105483
AA Change: M234V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101123
Gene: ENSMUSG00000056073
AA Change: M234V

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 298 3e-11 PFAM
Pfam:ANF_receptor 52 334 3.5e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105484
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: M234V

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000105485
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: M234V

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105486
AA Change: M234V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: M234V

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 3.8e-11 PFAM
Pfam:ANF_receptor 52 395 1.5e-74 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 6e-13 BLAST
low complexity region 875 891 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105487
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: M234V

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000218441
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000218598
AA Change: M234V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218669
AA Change: M5V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218823
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000220263
AA Change: M234V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,856,656 E54D possibly damaging Het
4933415F23Rik T C 1: 23,101,870 E121G probably damaging Het
Abcb6 C A 1: 75,177,358 G367W probably damaging Het
Asprv1 A G 6: 86,628,423 M84V probably damaging Het
Aspscr1 T C 11: 120,701,507 V291A probably damaging Het
B4galnt4 T C 7: 141,071,720 F980L probably damaging Het
Bpi G A 2: 158,272,021 V280I possibly damaging Het
Bptf T C 11: 107,095,880 D581G probably damaging Het
Cap2 T A 13: 46,639,826 Y223N possibly damaging Het
Ccdc141 A C 2: 77,057,980 I480M possibly damaging Het
Ccnh T A 13: 85,189,639 V35E probably benign Het
Cd6 G T 19: 10,794,225 S433* probably null Het
Ceacam10 A C 7: 24,781,052 I83L probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Chia1 A T 3: 106,122,449 D73V probably damaging Het
Commd2 G A 3: 57,646,794 T162I probably benign Het
Creb3l3 C T 10: 81,086,047 A316T probably benign Het
Cul4a A G 8: 13,123,526 K1R probably benign Het
Cyp2c23 T C 19: 44,016,737 probably null Het
D630045J12Rik T C 6: 38,196,841 T131A possibly damaging Het
Dctn4 A C 18: 60,550,236 K295N probably damaging Het
Dnah1 A G 14: 31,319,945 V23A probably benign Het
Dync1i1 A G 6: 5,767,048 K91E possibly damaging Het
Dzip1l A G 9: 99,642,651 D275G probably damaging Het
Enam C A 5: 88,501,543 P304T probably damaging Het
Enpep A G 3: 129,332,163 Y107H probably damaging Het
Exd2 T C 12: 80,480,576 L27P probably damaging Het
Fam135b T A 15: 71,464,055 D430V probably benign Het
Fam222b C T 11: 78,154,603 T202I possibly damaging Het
Fmod T A 1: 134,041,174 N317K probably damaging Het
Frem2 A G 3: 53,541,093 F2301L probably damaging Het
Frem3 T C 8: 80,611,459 F127S probably damaging Het
Gbp7 A G 3: 142,538,087 S132G probably benign Het
Gm4787 A G 12: 81,378,056 C443R probably damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,555,333 L429F probably damaging Het
Lrr1 C A 12: 69,174,462 T126K probably benign Het
Mgat4e C A 1: 134,542,028 D93Y probably damaging Het
Mllt3 A T 4: 87,840,781 S343R possibly damaging Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Mtrf1 C T 14: 79,411,650 H237Y probably damaging Het
Nckap1l T A 15: 103,473,056 L408Q probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr273 A G 4: 52,856,076 S146P possibly damaging Het
Olfr738 T G 14: 50,413,876 L111V possibly damaging Het
Otud7a T C 7: 63,735,915 S376P possibly damaging Het
Pabpc2 A T 18: 39,774,269 K196* probably null Het
Paqr8 T A 1: 20,935,413 C264S probably benign Het
Pgm2 T A 4: 99,981,979 F459Y probably benign Het
Phip C A 9: 82,908,869 V675L probably benign Het
Pnma1 T G 12: 84,147,723 T69P probably benign Het
Ptpn12 A T 5: 21,005,385 C242* probably null Het
Rabep1 T A 11: 70,908,468 V306E probably benign Het
Ros1 C T 10: 52,115,997 D1377N probably benign Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Scaf11 G A 15: 96,420,421 Q421* probably null Het
Shcbp1 G A 8: 4,744,512 T427M probably damaging Het
Shprh G A 10: 11,170,476 R979H probably damaging Het
Slc22a27 C T 19: 7,925,876 C163Y probably benign Het
Slc27a1 A G 8: 71,580,675 D287G probably damaging Het
Slc27a1 C T 8: 71,580,809 T310M possibly damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc35f2 A T 9: 53,771,785 M1L probably benign Het
Sltm G C 9: 70,581,365 R599T probably damaging Het
Spic T A 10: 88,675,890 Q168L probably damaging Het
Spink6 G A 18: 44,082,361 probably null Het
Stac2 T C 11: 98,041,372 E235G possibly damaging Het
Szt2 G A 4: 118,389,191 Q957* probably null Het
Them7 A T 2: 105,378,646 T104S possibly damaging Het
Tmed4 T A 11: 6,271,716 I207F possibly damaging Het
Tmem248 A G 5: 130,236,890 E178G probably benign Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Trim80 C A 11: 115,448,138 T598N possibly damaging Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Vil1 C T 1: 74,421,266 A194V probably damaging Het
Vmn2r61 A T 7: 42,267,141 M393L probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Vps33b G T 7: 80,290,048 A516S probably damaging Het
Wisp1 C A 15: 66,906,640 Y103* probably null Het
Zc3h6 G A 2: 129,002,240 G235R probably damaging Het
Zfp612 T A 8: 110,088,672 D170E probably benign Het
Zfp746 A G 6: 48,064,556 I412T probably benign Het
Other mutations in Grik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Grik2 APN 10 49355928 missense possibly damaging 0.95
IGL00979:Grik2 APN 10 49355938 missense probably damaging 1.00
IGL01012:Grik2 APN 10 49272956 missense probably damaging 1.00
IGL01302:Grik2 APN 10 49244330 missense probably damaging 0.99
IGL01657:Grik2 APN 10 49527986 critical splice donor site probably null
IGL02162:Grik2 APN 10 49422575 missense possibly damaging 0.77
IGL02317:Grik2 APN 10 49422615 missense probably benign 0.16
IGL02512:Grik2 APN 10 49355912 missense probably benign 0.00
IGL02650:Grik2 APN 10 49101235 missense probably benign 0.03
IGL03283:Grik2 APN 10 49578269 missense probably benign 0.00
R0325:Grik2 UTSW 10 49240725 missense probably damaging 1.00
R0492:Grik2 UTSW 10 49101164 missense probably damaging 0.99
R0601:Grik2 UTSW 10 49422597 missense probably damaging 1.00
R0844:Grik2 UTSW 10 49101115 missense possibly damaging 0.81
R1333:Grik2 UTSW 10 49527991 missense probably damaging 0.98
R1499:Grik2 UTSW 10 49132775 missense probably damaging 1.00
R1660:Grik2 UTSW 10 49244343 nonsense probably null
R1721:Grik2 UTSW 10 49523746 missense possibly damaging 0.93
R1966:Grik2 UTSW 10 49355909 missense probably damaging 1.00
R1974:Grik2 UTSW 10 49132827 missense possibly damaging 0.85
R2246:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R3103:Grik2 UTSW 10 49240772 missense probably damaging 1.00
R3974:Grik2 UTSW 10 49422654 missense probably damaging 1.00
R4592:Grik2 UTSW 10 49422615 missense possibly damaging 0.48
R4658:Grik2 UTSW 10 49523792 missense possibly damaging 0.71
R4935:Grik2 UTSW 10 49240730 missense probably damaging 1.00
R4977:Grik2 UTSW 10 49132745 missense probably damaging 1.00
R5103:Grik2 UTSW 10 49496109 missense probably benign 0.33
R5330:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5331:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5736:Grik2 UTSW 10 49404410 missense probably damaging 0.96
R5740:Grik2 UTSW 10 49113477 missense probably damaging 0.99
R5747:Grik2 UTSW 10 49523774 missense probably benign
R6015:Grik2 UTSW 10 49523863 splice site probably null
R6311:Grik2 UTSW 10 49578138 missense probably damaging 0.98
R6474:Grik2 UTSW 10 49132680 missense probably benign
R6504:Grik2 UTSW 10 49356102 missense probably damaging 1.00
R6591:Grik2 UTSW 10 49272925 nonsense probably null
R6691:Grik2 UTSW 10 49272925 nonsense probably null
R6776:Grik2 UTSW 10 49355989 missense probably damaging 1.00
R7015:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R7094:Grik2 UTSW 10 49355916 missense possibly damaging 0.75
R7153:Grik2 UTSW 10 49535367 missense probably benign 0.00
X0062:Grik2 UTSW 10 49272920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAATATGTTATTCCTGGGC -3'
(R):5'- ATGAGCTACTCTAATTTGCTTCCAC -3'

Sequencing Primer
(F):5'- CCTCATCCTAAATCTTGTTAAAGACC -3'
(R):5'- GCTCATCAAAGCTCCATC -3'
Posted On2015-11-11