Incidental Mutation 'R4749:Col14a1'
ID357433
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55452336 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1342 (F1342L)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: F1345L
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: F1345L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: F1346L
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: F1346L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: F1342L
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: F1342L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125416
AA Change: F84L
SMART Domains Protein: ENSMUSP00000122455
Gene: ENSMUSG00000022371
AA Change: F84L

DomainStartEndE-ValueType
TSPN 2 165 2.04e-42 SMART
Pfam:Collagen 201 255 2.1e-9 PFAM
Pfam:Collagen 253 305 3.3e-9 PFAM
Pfam:Collagen 295 355 4.4e-11 PFAM
Pfam:Collagen 393 448 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGGACTGTTCAGTGTCTCAGC -3'
(R):5'- CTCTGAAATCCAAAGCTTCATGAAG -3'

Sequencing Primer
(F):5'- AGCCCCTCATGTTGTTTTAAATGTG -3'
(R):5'- GTGGAGAATGCCTTTAATCCCAAC -3'
Posted On2015-11-11