Incidental Mutation 'R4749:Erg'
ID357435
Institutional Source Beutler Lab
Gene Symbol Erg
Ensembl Gene ENSMUSG00000040732
Gene NameETS transcription factor
SynonymsD030036I24Rik
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location95360204-95530365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95361170 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 342 (N342S)
Ref Sequence ENSEMBL: ENSMUSP00000113723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077773] [ENSMUST00000113846] [ENSMUST00000113848] [ENSMUST00000118113] [ENSMUST00000121809] [ENSMUST00000122199] [ENSMUST00000171646] [ENSMUST00000176345] [ENSMUST00000177450]
Predicted Effect probably damaging
Transcript: ENSMUST00000077773
AA Change: N342S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076949
Gene: ENSMUSG00000040732
AA Change: N342S

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 293 378 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113846
AA Change: N366S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109477
Gene: ENSMUSG00000040732
AA Change: N366S

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 317 402 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113848
AA Change: N366S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109479
Gene: ENSMUSG00000040732
AA Change: N366S

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 294 379 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118113
AA Change: N336S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112698
Gene: ENSMUSG00000040732
AA Change: N336S

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 287 372 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121809
AA Change: N342S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113723
Gene: ENSMUSG00000040732
AA Change: N342S

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 286 371 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122199
AA Change: N336S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114072
Gene: ENSMUSG00000040732
AA Change: N336S

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 310 395 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171646
AA Change: N319S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132766
Gene: ENSMUSG00000040732
AA Change: N319S

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 270 355 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176345
AA Change: N359S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135568
Gene: ENSMUSG00000040732
AA Change: N359S

DomainStartEndE-ValueType
SAM_PNT 23 107 6.99e-32 SMART
ETS 218 303 9.9e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177450
AA Change: N243S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134930
Gene: ENSMUSG00000040732
AA Change: N243S

DomainStartEndE-ValueType
SAM_PNT 23 107 6.99e-32 SMART
ETS 194 279 9.9e-58 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an ENU-induced mutation or a knock-out of isoforms 5 - 7 die during organogenesis and exhibit embryonic growth retardation. Mice homozygous for a knock-out of isoforms 1 - 4 are viable and fertile with no overt abnnormalities. Homozygous knock-out mice develop pulmonary venoocclusive disease, with pancytopenia, pulmonary hemorrhage and hypertension, and heart right ventricle hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Sort1 T G 3: 108,356,323 Y812* probably null Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Erg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Erg APN 16 95369989 splice site probably benign
IGL01096:Erg APN 16 95390053 splice site probably benign
IGL01446:Erg APN 16 95361282 missense probably damaging 1.00
IGL01459:Erg APN 16 95361282 missense probably damaging 1.00
IGL01984:Erg APN 16 95409927 missense probably damaging 1.00
IGL03164:Erg APN 16 95409871 missense possibly damaging 0.94
PIT4515001:Erg UTSW 16 95409760 missense probably benign 0.09
R0499:Erg UTSW 16 95360983 nonsense probably null
R0734:Erg UTSW 16 95370025 missense possibly damaging 0.61
R1880:Erg UTSW 16 95377309 missense probably benign 0.07
R2069:Erg UTSW 16 95361078 missense probably damaging 1.00
R4710:Erg UTSW 16 95390034 missense possibly damaging 0.92
R5053:Erg UTSW 16 95524534 missense probably benign 0.00
R5284:Erg UTSW 16 95459243 start codon destroyed probably null 0.01
R5694:Erg UTSW 16 95361031 missense probably benign 0.00
R6212:Erg UTSW 16 95379163 missense probably damaging 0.98
R6258:Erg UTSW 16 95380241 missense probably damaging 0.99
R6260:Erg UTSW 16 95380241 missense probably damaging 0.99
R6856:Erg UTSW 16 95368651 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATAGGAGCCCATGTATGGC -3'
(R):5'- GACTGAACCTTCTGTCCTTGG -3'

Sequencing Primer
(F):5'- AGCCCATGTATGGCAGGTC -3'
(R):5'- AACCTTCTGTCCTTGGTTCTGATTG -3'
Posted On2015-11-11