Incidental Mutation 'R4751:Ptpru'
ID357571
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
MMRRC Submission 041970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4751 (G1)
Quality Score181
Status Validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131802586 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 604 (S604P)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect probably damaging
Transcript: ENSMUST00000030741
AA Change: S604P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: S604P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097860
AA Change: S532P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: S532P

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000105987
AA Change: S604P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: S604P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154224
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 128,237,086 C112S probably benign Het
Abca13 G A 11: 9,277,973 probably null Het
Abca14 A G 7: 120,312,177 E1328G probably benign Het
Abca9 T A 11: 110,130,570 I1105F probably benign Het
Abr T C 11: 76,456,608 N396D possibly damaging Het
Aftph A C 11: 20,727,074 C178W probably damaging Het
Akr1c14 T C 13: 4,065,338 F89S possibly damaging Het
Ank3 C T 10: 69,986,206 A1518V probably benign Het
Arfgap2 T G 2: 91,267,368 S143R probably benign Het
Aspdh T A 7: 44,467,205 C107* probably null Het
Asphd2 C A 5: 112,391,746 G74W probably damaging Het
AU040320 G A 4: 126,854,466 probably null Het
B3glct T A 5: 149,725,402 probably null Het
Bcl9l A G 9: 44,506,803 K646R probably damaging Het
Brat1 T G 5: 140,718,296 L768R probably damaging Het
Btbd18 T A 2: 84,667,921 Y634* probably null Het
Bub1 T A 2: 127,823,938 probably benign Het
Carns1 A T 19: 4,166,418 D588E probably damaging Het
Cast T C 13: 74,746,047 K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chsy3 T C 18: 59,175,800 S42P possibly damaging Het
Clca1 A T 3: 145,004,848 F865I possibly damaging Het
Clec4f T A 6: 83,645,282 M526L possibly damaging Het
Clnk T C 5: 38,720,913 E301G probably benign Het
Colgalt2 T A 1: 152,489,876 I309N probably benign Het
Cyp2e1 A T 7: 140,774,716 K326* probably null Het
Dagla T A 19: 10,250,394 T717S probably benign Het
Dnajc11 G A 4: 151,968,542 R141H probably benign Het
Dst A G 1: 34,191,884 K2853E probably benign Het
Eif4g1 A G 16: 20,686,515 K1208E possibly damaging Het
Elane A G 10: 79,886,791 R48G probably benign Het
Fbxo30 T A 10: 11,290,195 N220K probably benign Het
Fbxo33 A T 12: 59,200,928 probably benign Het
Fetub G A 16: 22,937,895 V169I probably benign Het
Gm13762 A G 2: 88,973,133 C253R probably damaging Het
Gm5861 T A 5: 11,186,491 Y138N probably damaging Het
Gpx6 A C 13: 21,317,064 Q107H probably damaging Het
Hist2h2bb A T 3: 96,269,151 probably benign Het
Homer3 A T 8: 70,285,434 I19F probably damaging Het
Hspa4 C T 11: 53,284,199 V144I probably benign Het
Icos C T 1: 60,993,717 S25L probably benign Het
Ifna4 A G 4: 88,841,948 T30A probably benign Het
Ino80b C T 6: 83,124,750 G46D probably damaging Het
Kpna2 T G 11: 106,992,664 I100L possibly damaging Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Krtap31-2 A G 11: 99,936,576 N78S possibly damaging Het
Lman1 A G 18: 65,998,434 S132P probably benign Het
Lmna T C 3: 88,486,533 Q246R possibly damaging Het
Lrp10 T A 14: 54,468,592 V413E probably damaging Het
Macf1 A C 4: 123,471,650 I1541S probably benign Het
Med24 A G 11: 98,706,432 L874P probably damaging Het
Mgll T A 6: 88,725,111 probably benign Het
Mrpl37 A T 4: 107,057,475 L364Q probably damaging Het
Mrpl47 C T 3: 32,728,441 R209H probably benign Het
Muc5ac T C 7: 141,817,601 F3285L probably benign Het
Mylk A G 16: 34,879,169 R301G probably benign Het
Nacad A G 11: 6,605,726 L8P unknown Het
Ncf1 T A 5: 134,229,545 H8L probably damaging Het
Ncoa3 T A 2: 166,069,903 M1383K possibly damaging Het
Necab2 C T 8: 119,467,598 S271L probably benign Het
Nme8 A T 13: 19,675,638 probably null Het
Nsrp1 T G 11: 77,076,719 T16P possibly damaging Het
Obox3 A T 7: 15,625,692 probably null Het
Olfr1211 T A 2: 88,929,914 I134F probably damaging Het
Olfr1416 C A 1: 92,479,983 A213S probably benign Het
Olfr1428 T A 19: 12,109,177 Y123F probably damaging Het
Olfr355 T C 2: 36,927,583 H177R probably damaging Het
Olfr667 A T 7: 104,916,410 Y295* probably null Het
Osbpl3 C G 6: 50,300,997 E790Q possibly damaging Het
Osmr A T 15: 6,842,852 W254R probably damaging Het
Otoa T C 7: 121,132,924 probably benign Het
Pagr1a A T 7: 127,015,379 L218H probably damaging Het
Pcdha11 G A 18: 37,006,944 G542D probably damaging Het
Pck2 T A 14: 55,542,561 I54N probably damaging Het
Ppif T C 14: 25,699,499 V173A probably damaging Het
Ptgs2 T A 1: 150,104,020 L292H probably damaging Het
Qrfpr T C 3: 36,182,622 H210R possibly damaging Het
Rasgrf1 A G 9: 89,910,118 T41A probably damaging Het
Rasgrf1 A G 9: 90,012,866 H1113R probably damaging Het
Rhoc T A 3: 104,792,647 I80N probably damaging Het
Riok3 A G 18: 12,153,983 N472S probably benign Het
Rnf213 A G 11: 119,445,745 Y3314C probably benign Het
Shank2 C T 7: 144,409,468 T264I probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 A G 12: 82,341,194 I65V probably benign Het
Slc22a19 T C 19: 7,691,145 K291R possibly damaging Het
Slc22a20 T C 19: 5,980,460 I315V probably benign Het
Slc44a1 A T 4: 53,560,973 D563V probably damaging Het
Smchd1 A T 17: 71,391,468 H1104Q probably benign Het
Spcs2 A T 7: 99,844,769 probably null Het
Sptb T C 12: 76,627,110 E301G probably benign Het
Stum T C 1: 180,442,669 D86G probably damaging Het
Sufu A T 19: 46,483,649 D449V probably benign Het
Sun5 T C 2: 153,866,016 probably null Het
Tbc1d15 T A 10: 115,202,587 I574F probably damaging Het
Tert G A 13: 73,628,063 S311N possibly damaging Het
Tiparp T C 3: 65,552,804 Y507H probably damaging Het
Tnk2 T C 16: 32,679,857 C158R probably damaging Het
Tpgs1 T C 10: 79,675,620 S199P possibly damaging Het
Trdmt1 G T 2: 13,544,653 probably benign Het
Trp53bp1 T A 2: 121,227,809 D944V probably damaging Het
Tsc1 T A 2: 28,679,081 I720N probably damaging Het
Ttn T C 2: 76,709,605 T34346A probably benign Het
Ttn T C 2: 76,897,581 probably benign Het
Uba7 T A 9: 107,979,805 C686S possibly damaging Het
Ush2a T A 1: 188,850,087 F3782L probably damaging Het
Vars2 A T 17: 35,659,343 H745Q possibly damaging Het
Vgf T A 5: 137,032,401 D472E probably damaging Het
Vmn2r15 T C 5: 109,286,754 M695V probably benign Het
Vps41 A T 13: 18,811,622 D208V probably damaging Het
Vta1 C T 10: 14,655,816 A272T probably benign Het
Wnk4 G A 11: 101,276,362 probably benign Het
Zfp507 T C 7: 35,794,382 K412R probably damaging Het
Zfp768 A G 7: 127,344,762 F65L possibly damaging Het
Zfp956 T C 6: 47,963,576 S290P probably benign Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TTTCCACTGCCCAGAGTCATG -3'
(R):5'- TGGGTCAATCAGAGTTGAGGTC -3'

Sequencing Primer
(F):5'- AGAGTCATGGAGCACCCTC -3'
(R):5'- TCAGAGGTCAGTGTCTAAGAGC -3'
Posted On2015-11-11