Incidental Mutation 'R4751:Zfp768'
ID357596
Institutional Source Beutler Lab
Gene Symbol Zfp768
Ensembl Gene ENSMUSG00000047371
Gene Namezinc finger protein 768
Synonyms
MMRRC Submission 041970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R4751 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127342795-127345589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127344762 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 65 (F65L)
Ref Sequence ENSEMBL: ENSMUSP00000145704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060783] [ENSMUST00000205266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060783
AA Change: F68L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055374
Gene: ENSMUSG00000047371
AA Change: F68L

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 112 130 3.7e-4 PFAM
Pfam:RNA_pol_Rpb1_R 133 152 1.3e-4 PFAM
low complexity region 271 288 N/A INTRINSIC
ZnF_C2H2 289 311 7.15e-2 SMART
ZnF_C2H2 317 339 1.22e-4 SMART
ZnF_C2H2 345 367 1.5e-4 SMART
ZnF_C2H2 373 395 4.3e-5 SMART
ZnF_C2H2 401 423 4.24e-4 SMART
ZnF_C2H2 429 451 9.58e-3 SMART
ZnF_C2H2 457 479 1.47e-3 SMART
ZnF_C2H2 485 507 7.49e-5 SMART
ZnF_C2H2 513 535 1.03e-2 SMART
ZnF_C2H2 541 563 6.52e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205266
AA Change: F65L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 128,237,086 C112S probably benign Het
Abca13 G A 11: 9,277,973 probably null Het
Abca14 A G 7: 120,312,177 E1328G probably benign Het
Abca9 T A 11: 110,130,570 I1105F probably benign Het
Abr T C 11: 76,456,608 N396D possibly damaging Het
Aftph A C 11: 20,727,074 C178W probably damaging Het
Akr1c14 T C 13: 4,065,338 F89S possibly damaging Het
Ank3 C T 10: 69,986,206 A1518V probably benign Het
Arfgap2 T G 2: 91,267,368 S143R probably benign Het
Aspdh T A 7: 44,467,205 C107* probably null Het
Asphd2 C A 5: 112,391,746 G74W probably damaging Het
AU040320 G A 4: 126,854,466 probably null Het
B3glct T A 5: 149,725,402 probably null Het
Bcl9l A G 9: 44,506,803 K646R probably damaging Het
Brat1 T G 5: 140,718,296 L768R probably damaging Het
Btbd18 T A 2: 84,667,921 Y634* probably null Het
Bub1 T A 2: 127,823,938 probably benign Het
Carns1 A T 19: 4,166,418 D588E probably damaging Het
Cast T C 13: 74,746,047 K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chsy3 T C 18: 59,175,800 S42P possibly damaging Het
Clca1 A T 3: 145,004,848 F865I possibly damaging Het
Clec4f T A 6: 83,645,282 M526L possibly damaging Het
Clnk T C 5: 38,720,913 E301G probably benign Het
Colgalt2 T A 1: 152,489,876 I309N probably benign Het
Cyp2e1 A T 7: 140,774,716 K326* probably null Het
Dagla T A 19: 10,250,394 T717S probably benign Het
Dnajc11 G A 4: 151,968,542 R141H probably benign Het
Dst A G 1: 34,191,884 K2853E probably benign Het
Eif4g1 A G 16: 20,686,515 K1208E possibly damaging Het
Elane A G 10: 79,886,791 R48G probably benign Het
Fbxo30 T A 10: 11,290,195 N220K probably benign Het
Fbxo33 A T 12: 59,200,928 probably benign Het
Fetub G A 16: 22,937,895 V169I probably benign Het
Gm13762 A G 2: 88,973,133 C253R probably damaging Het
Gm5861 T A 5: 11,186,491 Y138N probably damaging Het
Gpx6 A C 13: 21,317,064 Q107H probably damaging Het
Hist2h2bb A T 3: 96,269,151 probably benign Het
Homer3 A T 8: 70,285,434 I19F probably damaging Het
Hspa4 C T 11: 53,284,199 V144I probably benign Het
Icos C T 1: 60,993,717 S25L probably benign Het
Ifna4 A G 4: 88,841,948 T30A probably benign Het
Ino80b C T 6: 83,124,750 G46D probably damaging Het
Kpna2 T G 11: 106,992,664 I100L possibly damaging Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Krtap31-2 A G 11: 99,936,576 N78S possibly damaging Het
Lman1 A G 18: 65,998,434 S132P probably benign Het
Lmna T C 3: 88,486,533 Q246R possibly damaging Het
Lrp10 T A 14: 54,468,592 V413E probably damaging Het
Macf1 A C 4: 123,471,650 I1541S probably benign Het
Med24 A G 11: 98,706,432 L874P probably damaging Het
Mgll T A 6: 88,725,111 probably benign Het
Mrpl37 A T 4: 107,057,475 L364Q probably damaging Het
Mrpl47 C T 3: 32,728,441 R209H probably benign Het
Muc5ac T C 7: 141,817,601 F3285L probably benign Het
Mylk A G 16: 34,879,169 R301G probably benign Het
Nacad A G 11: 6,605,726 L8P unknown Het
Ncf1 T A 5: 134,229,545 H8L probably damaging Het
Ncoa3 T A 2: 166,069,903 M1383K possibly damaging Het
Necab2 C T 8: 119,467,598 S271L probably benign Het
Nme8 A T 13: 19,675,638 probably null Het
Nsrp1 T G 11: 77,076,719 T16P possibly damaging Het
Obox3 A T 7: 15,625,692 probably null Het
Olfr1211 T A 2: 88,929,914 I134F probably damaging Het
Olfr1416 C A 1: 92,479,983 A213S probably benign Het
Olfr1428 T A 19: 12,109,177 Y123F probably damaging Het
Olfr355 T C 2: 36,927,583 H177R probably damaging Het
Olfr667 A T 7: 104,916,410 Y295* probably null Het
Osbpl3 C G 6: 50,300,997 E790Q possibly damaging Het
Osmr A T 15: 6,842,852 W254R probably damaging Het
Otoa T C 7: 121,132,924 probably benign Het
Pagr1a A T 7: 127,015,379 L218H probably damaging Het
Pcdha11 G A 18: 37,006,944 G542D probably damaging Het
Pck2 T A 14: 55,542,561 I54N probably damaging Het
Ppif T C 14: 25,699,499 V173A probably damaging Het
Ptgs2 T A 1: 150,104,020 L292H probably damaging Het
Ptpru A G 4: 131,802,586 S604P probably damaging Het
Qrfpr T C 3: 36,182,622 H210R possibly damaging Het
Rasgrf1 A G 9: 89,910,118 T41A probably damaging Het
Rasgrf1 A G 9: 90,012,866 H1113R probably damaging Het
Rhoc T A 3: 104,792,647 I80N probably damaging Het
Riok3 A G 18: 12,153,983 N472S probably benign Het
Rnf213 A G 11: 119,445,745 Y3314C probably benign Het
Shank2 C T 7: 144,409,468 T264I probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 A G 12: 82,341,194 I65V probably benign Het
Slc22a19 T C 19: 7,691,145 K291R possibly damaging Het
Slc22a20 T C 19: 5,980,460 I315V probably benign Het
Slc44a1 A T 4: 53,560,973 D563V probably damaging Het
Smchd1 A T 17: 71,391,468 H1104Q probably benign Het
Spcs2 A T 7: 99,844,769 probably null Het
Sptb T C 12: 76,627,110 E301G probably benign Het
Stum T C 1: 180,442,669 D86G probably damaging Het
Sufu A T 19: 46,483,649 D449V probably benign Het
Sun5 T C 2: 153,866,016 probably null Het
Tbc1d15 T A 10: 115,202,587 I574F probably damaging Het
Tert G A 13: 73,628,063 S311N possibly damaging Het
Tiparp T C 3: 65,552,804 Y507H probably damaging Het
Tnk2 T C 16: 32,679,857 C158R probably damaging Het
Tpgs1 T C 10: 79,675,620 S199P possibly damaging Het
Trdmt1 G T 2: 13,544,653 probably benign Het
Trp53bp1 T A 2: 121,227,809 D944V probably damaging Het
Tsc1 T A 2: 28,679,081 I720N probably damaging Het
Ttn T C 2: 76,709,605 T34346A probably benign Het
Ttn T C 2: 76,897,581 probably benign Het
Uba7 T A 9: 107,979,805 C686S possibly damaging Het
Ush2a T A 1: 188,850,087 F3782L probably damaging Het
Vars2 A T 17: 35,659,343 H745Q possibly damaging Het
Vgf T A 5: 137,032,401 D472E probably damaging Het
Vmn2r15 T C 5: 109,286,754 M695V probably benign Het
Vps41 A T 13: 18,811,622 D208V probably damaging Het
Vta1 C T 10: 14,655,816 A272T probably benign Het
Wnk4 G A 11: 101,276,362 probably benign Het
Zfp507 T C 7: 35,794,382 K412R probably damaging Het
Zfp956 T C 6: 47,963,576 S290P probably benign Het
Other mutations in Zfp768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp768 APN 7 127344531 missense possibly damaging 0.80
IGL03236:Zfp768 APN 7 127343970 missense possibly damaging 0.93
R1490:Zfp768 UTSW 7 127343631 missense probably damaging 1.00
R1497:Zfp768 UTSW 7 127343561 missense probably damaging 1.00
R2251:Zfp768 UTSW 7 127344378 missense probably benign
R2298:Zfp768 UTSW 7 127344189 missense probably benign 0.11
R2360:Zfp768 UTSW 7 127344638 missense probably benign 0.43
R4795:Zfp768 UTSW 7 127343375 missense possibly damaging 0.60
R5011:Zfp768 UTSW 7 127343703 missense probably damaging 1.00
R5518:Zfp768 UTSW 7 127344411 missense probably benign
R5602:Zfp768 UTSW 7 127344632 missense possibly damaging 0.73
R5876:Zfp768 UTSW 7 127344546 missense probably benign 0.01
R6245:Zfp768 UTSW 7 127344091 nonsense probably null
R6273:Zfp768 UTSW 7 127345147 critical splice donor site probably null
R6376:Zfp768 UTSW 7 127344720 missense probably benign 0.34
R6475:Zfp768 UTSW 7 127344655 missense probably damaging 0.97
R7125:Zfp768 UTSW 7 127344787 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATACCTAGGACTCCCAGGTTC -3'
(R):5'- TGGACCCAATGACCTTCCAGAC -3'

Sequencing Primer
(F):5'- CTTCGGGGCTCATACTTAGGAC -3'
(R):5'- AGACCCCCATTCAATCTGGATTTTC -3'
Posted On2015-11-11