Incidental Mutation 'R4751:Osmr'
ID357637
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
MMRRC Submission 041970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4751 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6842852 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 254 (W254R)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably damaging
Transcript: ENSMUST00000022746
AA Change: W254R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: W254R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175862
Predicted Effect probably damaging
Transcript: ENSMUST00000176826
AA Change: W254R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: W254R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177478
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 128,237,086 C112S probably benign Het
Abca13 G A 11: 9,277,973 probably null Het
Abca14 A G 7: 120,312,177 E1328G probably benign Het
Abca9 T A 11: 110,130,570 I1105F probably benign Het
Abr T C 11: 76,456,608 N396D possibly damaging Het
Aftph A C 11: 20,727,074 C178W probably damaging Het
Akr1c14 T C 13: 4,065,338 F89S possibly damaging Het
Ank3 C T 10: 69,986,206 A1518V probably benign Het
Arfgap2 T G 2: 91,267,368 S143R probably benign Het
Aspdh T A 7: 44,467,205 C107* probably null Het
Asphd2 C A 5: 112,391,746 G74W probably damaging Het
AU040320 G A 4: 126,854,466 probably null Het
B3glct T A 5: 149,725,402 probably null Het
Bcl9l A G 9: 44,506,803 K646R probably damaging Het
Brat1 T G 5: 140,718,296 L768R probably damaging Het
Btbd18 T A 2: 84,667,921 Y634* probably null Het
Bub1 T A 2: 127,823,938 probably benign Het
Carns1 A T 19: 4,166,418 D588E probably damaging Het
Cast T C 13: 74,746,047 K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chsy3 T C 18: 59,175,800 S42P possibly damaging Het
Clca1 A T 3: 145,004,848 F865I possibly damaging Het
Clec4f T A 6: 83,645,282 M526L possibly damaging Het
Clnk T C 5: 38,720,913 E301G probably benign Het
Colgalt2 T A 1: 152,489,876 I309N probably benign Het
Cyp2e1 A T 7: 140,774,716 K326* probably null Het
Dagla T A 19: 10,250,394 T717S probably benign Het
Dnajc11 G A 4: 151,968,542 R141H probably benign Het
Dst A G 1: 34,191,884 K2853E probably benign Het
Eif4g1 A G 16: 20,686,515 K1208E possibly damaging Het
Elane A G 10: 79,886,791 R48G probably benign Het
Fbxo30 T A 10: 11,290,195 N220K probably benign Het
Fbxo33 A T 12: 59,200,928 probably benign Het
Fetub G A 16: 22,937,895 V169I probably benign Het
Gm13762 A G 2: 88,973,133 C253R probably damaging Het
Gm5861 T A 5: 11,186,491 Y138N probably damaging Het
Gpx6 A C 13: 21,317,064 Q107H probably damaging Het
Hist2h2bb A T 3: 96,269,151 probably benign Het
Homer3 A T 8: 70,285,434 I19F probably damaging Het
Hspa4 C T 11: 53,284,199 V144I probably benign Het
Icos C T 1: 60,993,717 S25L probably benign Het
Ifna4 A G 4: 88,841,948 T30A probably benign Het
Ino80b C T 6: 83,124,750 G46D probably damaging Het
Kpna2 T G 11: 106,992,664 I100L possibly damaging Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Krtap31-2 A G 11: 99,936,576 N78S possibly damaging Het
Lman1 A G 18: 65,998,434 S132P probably benign Het
Lmna T C 3: 88,486,533 Q246R possibly damaging Het
Lrp10 T A 14: 54,468,592 V413E probably damaging Het
Macf1 A C 4: 123,471,650 I1541S probably benign Het
Med24 A G 11: 98,706,432 L874P probably damaging Het
Mgll T A 6: 88,725,111 probably benign Het
Mrpl37 A T 4: 107,057,475 L364Q probably damaging Het
Mrpl47 C T 3: 32,728,441 R209H probably benign Het
Muc5ac T C 7: 141,817,601 F3285L probably benign Het
Mylk A G 16: 34,879,169 R301G probably benign Het
Nacad A G 11: 6,605,726 L8P unknown Het
Ncf1 T A 5: 134,229,545 H8L probably damaging Het
Ncoa3 T A 2: 166,069,903 M1383K possibly damaging Het
Necab2 C T 8: 119,467,598 S271L probably benign Het
Nme8 A T 13: 19,675,638 probably null Het
Nsrp1 T G 11: 77,076,719 T16P possibly damaging Het
Obox3 A T 7: 15,625,692 probably null Het
Olfr1211 T A 2: 88,929,914 I134F probably damaging Het
Olfr1416 C A 1: 92,479,983 A213S probably benign Het
Olfr1428 T A 19: 12,109,177 Y123F probably damaging Het
Olfr355 T C 2: 36,927,583 H177R probably damaging Het
Olfr667 A T 7: 104,916,410 Y295* probably null Het
Osbpl3 C G 6: 50,300,997 E790Q possibly damaging Het
Otoa T C 7: 121,132,924 probably benign Het
Pagr1a A T 7: 127,015,379 L218H probably damaging Het
Pcdha11 G A 18: 37,006,944 G542D probably damaging Het
Pck2 T A 14: 55,542,561 I54N probably damaging Het
Ppif T C 14: 25,699,499 V173A probably damaging Het
Ptgs2 T A 1: 150,104,020 L292H probably damaging Het
Ptpru A G 4: 131,802,586 S604P probably damaging Het
Qrfpr T C 3: 36,182,622 H210R possibly damaging Het
Rasgrf1 A G 9: 89,910,118 T41A probably damaging Het
Rasgrf1 A G 9: 90,012,866 H1113R probably damaging Het
Rhoc T A 3: 104,792,647 I80N probably damaging Het
Riok3 A G 18: 12,153,983 N472S probably benign Het
Rnf213 A G 11: 119,445,745 Y3314C probably benign Het
Shank2 C T 7: 144,409,468 T264I probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 A G 12: 82,341,194 I65V probably benign Het
Slc22a19 T C 19: 7,691,145 K291R possibly damaging Het
Slc22a20 T C 19: 5,980,460 I315V probably benign Het
Slc44a1 A T 4: 53,560,973 D563V probably damaging Het
Smchd1 A T 17: 71,391,468 H1104Q probably benign Het
Spcs2 A T 7: 99,844,769 probably null Het
Sptb T C 12: 76,627,110 E301G probably benign Het
Stum T C 1: 180,442,669 D86G probably damaging Het
Sufu A T 19: 46,483,649 D449V probably benign Het
Sun5 T C 2: 153,866,016 probably null Het
Tbc1d15 T A 10: 115,202,587 I574F probably damaging Het
Tert G A 13: 73,628,063 S311N possibly damaging Het
Tiparp T C 3: 65,552,804 Y507H probably damaging Het
Tnk2 T C 16: 32,679,857 C158R probably damaging Het
Tpgs1 T C 10: 79,675,620 S199P possibly damaging Het
Trdmt1 G T 2: 13,544,653 probably benign Het
Trp53bp1 T A 2: 121,227,809 D944V probably damaging Het
Tsc1 T A 2: 28,679,081 I720N probably damaging Het
Ttn T C 2: 76,709,605 T34346A probably benign Het
Ttn T C 2: 76,897,581 probably benign Het
Uba7 T A 9: 107,979,805 C686S possibly damaging Het
Ush2a T A 1: 188,850,087 F3782L probably damaging Het
Vars2 A T 17: 35,659,343 H745Q possibly damaging Het
Vgf T A 5: 137,032,401 D472E probably damaging Het
Vmn2r15 T C 5: 109,286,754 M695V probably benign Het
Vps41 A T 13: 18,811,622 D208V probably damaging Het
Vta1 C T 10: 14,655,816 A272T probably benign Het
Wnk4 G A 11: 101,276,362 probably benign Het
Zfp507 T C 7: 35,794,382 K412R probably damaging Het
Zfp768 A G 7: 127,344,762 F65L possibly damaging Het
Zfp956 T C 6: 47,963,576 S290P probably benign Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense not run
Predicted Primers PCR Primer
(F):5'- GACACATCCAAGAGTATGTGTGTC -3'
(R):5'- ACCTGAAGAGCCTTTCTGGG -3'

Sequencing Primer
(F):5'- ACATCCAAGAGTATGTGTGTCTTCTC -3'
(R):5'- GGGCTATTGATCTGCTGACTTCC -3'
Posted On2015-11-11