Incidental Mutation 'R4752:Tgm4'
ID357682
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Nametransglutaminase 4 (prostate)
Synonyms9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
MMRRC Submission 042032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4752 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123034726-123067561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123051386 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 284 (D284G)
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
Predicted Effect probably damaging
Transcript: ENSMUST00000026893
AA Change: D284G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: D284G

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171897
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,069,990 Q1647K possibly damaging Het
Abcf3 A G 16: 20,550,576 E236G probably damaging Het
Adamts17 A G 7: 67,004,470 T483A probably damaging Het
Ankrd26 G T 6: 118,540,465 P465Q probably null Het
Babam2 C T 5: 31,702,047 probably benign Het
Bpifb1 T A 2: 154,216,280 probably benign Het
Ccnb1ip1 T A 14: 50,793,665 T64S possibly damaging Het
Cdhr3 A G 12: 33,086,103 V46A probably damaging Het
Cep170 A T 1: 176,756,688 D708E probably benign Het
Cpsf6 A T 10: 117,361,368 probably benign Het
Cryzl2 C T 1: 157,458,649 probably null Het
Dgka A T 10: 128,736,659 F42I probably benign Het
Dip2a A T 10: 76,276,657 V1059E probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock4 T A 12: 40,446,365 I3K probably benign Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Eif2b4 G A 5: 31,191,231 R213* probably null Het
Eif3b A G 5: 140,441,101 D704G probably benign Het
Epn2 T C 11: 61,546,371 E125G probably damaging Het
F830016B08Rik A G 18: 60,301,081 N412S probably benign Het
Fbln2 A G 6: 91,256,243 M570V probably benign Het
Gm16686 A T 4: 88,755,488 probably benign Het
Hook2 C T 8: 85,002,720 Q632* probably null Het
Ipcef1 A T 10: 6,979,573 W56R probably damaging Het
Krt78 T C 15: 101,948,202 I418M probably benign Het
Limk1 G A 5: 134,670,441 T154I probably damaging Het
Lyl1 A T 8: 84,704,281 T271S probably benign Het
Megf6 A G 4: 154,252,438 I333V probably damaging Het
Meioc A G 11: 102,674,433 T236A probably benign Het
Nbas A G 12: 13,482,537 T1749A possibly damaging Het
Nfib T A 4: 82,296,779 Q529L probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nisch A T 14: 31,192,588 F42L probably damaging Het
Nomo1 T A 7: 46,057,202 Y547N probably damaging Het
Olfr1157 A G 2: 87,962,349 L181P probably damaging Het
Olfr1512 C T 14: 52,372,307 V249I probably damaging Het
Olfr538 T C 7: 140,574,602 S150P possibly damaging Het
Olfr919 T C 9: 38,697,970 Y136C probably damaging Het
Park2 T C 17: 12,004,123 S387P probably benign Het
Pcdh18 T A 3: 49,755,114 N117I probably damaging Het
Prl3c1 A T 13: 27,203,525 K164N probably benign Het
Prr23a3 T A 9: 98,865,647 L218Q probably damaging Het
Prss43 A G 9: 110,827,768 H114R possibly damaging Het
Ptcd3 A T 6: 71,901,312 M142K probably damaging Het
Shisa7 G A 7: 4,834,250 T89I possibly damaging Het
Slco1a1 C T 6: 141,946,614 A9T possibly damaging Het
Srcap C T 7: 127,559,000 probably benign Het
Tdg-ps G A 15: 82,516,371 noncoding transcript Het
Tmc1 T A 19: 20,826,649 I355F probably benign Het
Tmem121b A T 6: 120,493,034 F241I possibly damaging Het
Tmem200c T A 17: 68,842,240 V606E probably benign Het
Ttc39c A G 18: 12,728,725 K370R probably benign Het
Vmn2r87 G A 10: 130,478,467 Q417* probably null Het
Vps45 T C 3: 96,048,387 Y97C possibly damaging Het
Zfp407 A G 18: 84,562,914 S25P probably benign Het
Zfp566 A G 7: 30,077,881 S292P probably damaging Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0644:Tgm4 UTSW 9 123051458 missense probably damaging 1.00
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4407:Tgm4 UTSW 9 123056530 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6956:Tgm4 UTSW 9 123064703 missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCATTATGTCACCAGGATGCC -3'
(R):5'- ACTATGCAAAGTGGGTTTCTGG -3'

Sequencing Primer
(F):5'- AGGATGCCTGTACGCTACG -3'
(R):5'- GTGTTGATACTGCTCACAATTTGAAC -3'
Posted On2015-11-11