Incidental Mutation 'R4753:Dtl'
ID357714
Institutional Source Beutler Lab
Gene Symbol Dtl
Ensembl Gene ENSMUSG00000037474
Gene Namedenticleless E3 ubiquitin protein ligase
Synonyms5730564G15Rik, 2810047L02Rik
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4753 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191537356-191575544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191569703 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 81 (T81A)
Ref Sequence ENSEMBL: ENSMUSP00000141218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027933] [ENSMUST00000193977] [ENSMUST00000195650]
Predicted Effect probably damaging
Transcript: ENSMUST00000027933
AA Change: T81A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027933
Gene: ENSMUSG00000037474
AA Change: T81A

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-24 BLAST
WD40 87 126 2.61e-3 SMART
WD40 129 169 8.04e-4 SMART
WD40 205 244 8.29e-1 SMART
Blast:WD40 265 299 1e-11 BLAST
WD40 304 345 1.29e-2 SMART
WD40 349 389 1.07e-8 SMART
low complexity region 427 454 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 674 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192014
Predicted Effect probably damaging
Transcript: ENSMUST00000193977
AA Change: T81A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142111
Gene: ENSMUSG00000037474
AA Change: T81A

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-26 BLAST
SCOP:d1e1aa_ 65 108 6e-5 SMART
Blast:WD40 87 113 6e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194064
Predicted Effect probably damaging
Transcript: ENSMUST00000195650
AA Change: T81A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141218
Gene: ENSMUSG00000037474
AA Change: T81A

DomainStartEndE-ValueType
Blast:WD40 30 80 2e-26 BLAST
WD40 87 126 1.6e-5 SMART
Blast:WD40 129 154 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195765
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mutation of this gene results in very early embryonic lethality around or before E1.5. In vitro siRNA knockdown experiments show that the gene is essential cell survival and cell cycle progression to allow proper blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Thnsl1 C T 2: 21,213,364 T122I probably damaging Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Dtl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Dtl APN 1 191546626 splice site probably null
IGL01069:Dtl APN 1 191561539 critical splice acceptor site probably null
IGL01135:Dtl APN 1 191548330 missense probably damaging 1.00
IGL01307:Dtl APN 1 191570699 missense possibly damaging 0.78
IGL01461:Dtl APN 1 191546617 missense possibly damaging 0.88
IGL01809:Dtl APN 1 191548303 missense probably damaging 1.00
IGL01958:Dtl APN 1 191568377 missense probably damaging 1.00
IGL02217:Dtl APN 1 191568314 missense probably damaging 1.00
IGL02408:Dtl APN 1 191541240 missense probably benign 0.00
IGL02445:Dtl APN 1 191558060 critical splice donor site probably null
IGL02661:Dtl APN 1 191541371 missense probably benign 0.09
IGL02864:Dtl APN 1 191556826 missense probably benign 0.04
IGL02897:Dtl APN 1 191541544 splice site probably benign
IGL03069:Dtl APN 1 191556896 splice site probably benign
R0370:Dtl UTSW 1 191575350 missense probably benign 0.05
R0513:Dtl UTSW 1 191569707 nonsense probably null
R1386:Dtl UTSW 1 191569717 missense probably damaging 1.00
R1424:Dtl UTSW 1 191561537 missense probably benign 0.13
R1575:Dtl UTSW 1 191561546 splice site probably null
R2128:Dtl UTSW 1 191558110 missense probably damaging 0.99
R2297:Dtl UTSW 1 191541095 missense probably benign 0.41
R2344:Dtl UTSW 1 191548378 missense probably benign 0.00
R3121:Dtl UTSW 1 191553063 nonsense probably null
R3808:Dtl UTSW 1 191548354 missense probably damaging 1.00
R4722:Dtl UTSW 1 191556841 missense possibly damaging 0.52
R4904:Dtl UTSW 1 191568345 missense probably damaging 0.99
R4965:Dtl UTSW 1 191546565 missense possibly damaging 0.93
R5068:Dtl UTSW 1 191568373 missense probably damaging 1.00
R5119:Dtl UTSW 1 191541506 missense probably damaging 1.00
R5872:Dtl UTSW 1 191546568 missense probably benign 0.00
R5911:Dtl UTSW 1 191568407 missense probably damaging 1.00
R5992:Dtl UTSW 1 191568572 intron probably null
R6425:Dtl UTSW 1 191546623 missense probably benign 0.02
X0018:Dtl UTSW 1 191568410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCACTTATCTCTCACCTATCAC -3'
(R):5'- ATGGGCCAGTACCACTCTTG -3'

Sequencing Primer
(F):5'- TCACCTATCACGTGCATGG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2015-11-11