Incidental Mutation 'R4753:Thnsl1'
ID357715
Institutional Source Beutler Lab
Gene Symbol Thnsl1
Ensembl Gene ENSMUSG00000048550
Gene Namethreonine synthase-like 1 (bacterial)
Synonyms
MMRRC Submission 041971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4753 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location21205724-21215009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21213364 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 122 (T122I)
Ref Sequence ENSEMBL: ENSMUSP00000100017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054591] [ENSMUST00000102951] [ENSMUST00000102952] [ENSMUST00000138914] [ENSMUST00000138965]
Predicted Effect probably damaging
Transcript: ENSMUST00000054591
AA Change: T643I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052452
Gene: ENSMUSG00000048550
AA Change: T643I

DomainStartEndE-ValueType
Pfam:AAA_17 57 202 2e-8 PFAM
Pfam:SKI 64 221 5.8e-40 PFAM
Pfam:Thr_synth_N 230 318 3.2e-16 PFAM
Pfam:PALP 326 659 2.2e-9 PFAM
low complexity region 684 701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102951
AA Change: T122I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100016
Gene: ENSMUSG00000048550
AA Change: T122I

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102952
AA Change: T122I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100017
Gene: ENSMUSG00000048550
AA Change: T122I

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138914
Predicted Effect probably benign
Transcript: ENSMUST00000138965
SMART Domains Protein: ENSMUSP00000115186
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 93 5e-16 PDB
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T A 13: 112,363,475 D257E probably benign Het
Arhgef18 T C 8: 3,444,938 V399A probably damaging Het
Atp8b5 C T 4: 43,372,710 P1117S probably damaging Het
Cd48 A G 1: 171,699,588 Q194R probably damaging Het
Cdk13 G A 13: 17,763,248 R737C probably damaging Het
Clasrp A T 7: 19,594,940 I89N probably damaging Het
Clrn1 G T 3: 58,884,897 N48K probably damaging Het
Cntrl T A 2: 35,153,439 V1313E possibly damaging Het
Cyld T A 8: 88,744,816 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dtl T C 1: 191,569,703 T81A probably damaging Het
Dus1l C T 11: 120,792,075 E299K probably benign Het
E130114P18Rik A T 4: 97,574,892 D14E possibly damaging Het
Fam83g C A 11: 61,695,269 H228N probably damaging Het
Fhod3 A T 18: 25,090,325 K909N possibly damaging Het
Fign T A 2: 63,979,019 I636L probably benign Het
Foxm1 A G 6: 128,372,556 E346G probably null Het
Gcc2 T C 10: 58,290,382 Y1271H probably benign Het
Gcn1l1 T C 5: 115,616,478 V2379A probably benign Het
Grin2d G T 7: 45,833,906 P949Q probably damaging Het
Ighv1-43 C A 12: 114,946,142 M53I probably benign Het
Itgad A G 7: 128,223,703 *97W probably null Het
Jade1 C T 3: 41,596,671 R2* probably null Het
Lama3 G T 18: 12,482,084 C1355F probably damaging Het
Map3k13 T C 16: 21,892,002 S12P probably benign Het
Masp2 A G 4: 148,612,151 T402A probably benign Het
Mill1 A C 7: 18,262,547 K96T probably benign Het
Muc19 T G 15: 91,877,761 noncoding transcript Het
Muc5b C A 7: 141,856,853 T1321N unknown Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr1377 T C 11: 50,985,151 V150A probably benign Het
Olfr395 T A 11: 73,906,851 I214F probably damaging Het
Pdgfra C T 5: 75,181,524 P669S probably damaging Het
Procr A G 2: 155,753,464 N63D probably damaging Het
Prrc2c A G 1: 162,691,230 S2136P probably damaging Het
Rab11fip1 T C 8: 27,152,741 M677V probably benign Het
Rad52 T A 6: 119,912,985 probably benign Het
Rasa1 A G 13: 85,288,390 probably null Het
Rogdi T C 16: 5,010,499 T189A probably damaging Het
Rph3al G A 11: 75,909,019 T38M probably damaging Het
Rps6ka2 T A 17: 7,299,308 V655E possibly damaging Het
Sik3 T C 9: 46,198,214 F499L probably damaging Het
Skint4 A G 4: 112,146,531 N387S probably benign Het
Slc6a12 C T 6: 121,356,903 probably benign Het
Stk36 A G 1: 74,626,096 T667A probably benign Het
Svep1 T C 4: 58,053,212 I3378V probably benign Het
Timeless G A 10: 128,240,020 probably benign Het
Tnxb G A 17: 34,695,935 V1966I possibly damaging Het
Tril A G 6: 53,819,713 F175L probably damaging Het
Vav1 A G 17: 57,306,140 Y604C probably damaging Het
Zfp423 T A 8: 87,781,446 M736L probably benign Het
Zscan10 A C 17: 23,607,234 E123D probably damaging Het
Other mutations in Thnsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Thnsl1 APN 2 21212449 missense possibly damaging 0.47
IGL00756:Thnsl1 APN 2 21212612 missense probably benign 0.02
IGL00952:Thnsl1 APN 2 21211956 missense possibly damaging 0.89
IGL01020:Thnsl1 APN 2 21212494 missense probably damaging 0.99
IGL01350:Thnsl1 APN 2 21212200 missense probably benign 0.30
IGL01476:Thnsl1 APN 2 21212159 missense probably benign 0.00
IGL01548:Thnsl1 APN 2 21213132 missense probably damaging 1.00
IGL01916:Thnsl1 APN 2 21212665 missense possibly damaging 0.66
IGL02176:Thnsl1 APN 2 21211854 missense possibly damaging 0.69
IGL03001:Thnsl1 APN 2 21211644 missense probably damaging 0.99
IGL03219:Thnsl1 APN 2 21212406 missense probably benign 0.14
IGL03386:Thnsl1 APN 2 21211548 missense probably benign 0.01
R0684:Thnsl1 UTSW 2 21211666 missense probably benign 0.02
R0738:Thnsl1 UTSW 2 21213362 missense probably damaging 1.00
R1119:Thnsl1 UTSW 2 21213046 missense probably damaging 1.00
R1121:Thnsl1 UTSW 2 21212164 missense probably benign 0.00
R2150:Thnsl1 UTSW 2 21212533 missense probably benign 0.08
R3545:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R3547:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R4244:Thnsl1 UTSW 2 21212248 missense probably benign
R4245:Thnsl1 UTSW 2 21212248 missense probably benign
R4510:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4511:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4678:Thnsl1 UTSW 2 21211541 splice site probably null
R4795:Thnsl1 UTSW 2 21212045 nonsense probably null
R4796:Thnsl1 UTSW 2 21212045 nonsense probably null
R5584:Thnsl1 UTSW 2 21213412 missense probably damaging 1.00
R5586:Thnsl1 UTSW 2 21212390 nonsense probably null
R5682:Thnsl1 UTSW 2 21212068 missense possibly damaging 0.69
R5718:Thnsl1 UTSW 2 21212000 missense possibly damaging 0.54
R6159:Thnsl1 UTSW 2 21212205 nonsense probably null
R6795:Thnsl1 UTSW 2 21213492 nonsense probably null
R7084:Thnsl1 UTSW 2 21212330 missense possibly damaging 0.69
R7153:Thnsl1 UTSW 2 21212953 missense possibly damaging 0.64
R7243:Thnsl1 UTSW 2 21212847 missense probably damaging 1.00
R7265:Thnsl1 UTSW 2 21212458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTCAAGTCTTCCAACCTGG -3'
(R):5'- ATGCATTGTACGAGCTCAGTAAG -3'

Sequencing Primer
(F):5'- CCAACCTGGAGCGACATTTATACTTG -3'
(R):5'- CATTGTACGAGCTCAGTAAGTAAAGC -3'
Posted On2015-11-11